ID: 1121369567

View in Genome Browser
Species Human (GRCh38)
Location 14:93344808-93344830
Sequence GAGAACAAGGAGATGAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121369561_1121369567 14 Left 1121369561 14:93344771-93344793 CCTGATGTGACTGGGCAGGATGA 0: 1
1: 0
2: 4
3: 10
4: 150
Right 1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG 0: 1
1: 0
2: 0
3: 43
4: 433
1121369564_1121369567 -10 Left 1121369564 14:93344795-93344817 CCAAGGGAAGACTGAGAACAAGG 0: 1
1: 0
2: 2
3: 22
4: 274
Right 1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG 0: 1
1: 0
2: 0
3: 43
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121369567 Original CRISPR GAGAACAAGGAGATGAGGTT AGG Intronic
901918639 1:12519837-12519859 GAGCACAATGAGAGGAGGTGGGG + Intergenic
902560281 1:17273077-17273099 GAGAACATGGACATGACCTTGGG - Intronic
903472302 1:23595659-23595681 GAGGACAAGGAGAGGACATTGGG - Intronic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
904119115 1:28184539-28184561 GAGATGTAGGAGATGAGGTGAGG - Intronic
904133665 1:28294166-28294188 GAGCACAAGGAAATTAGATTTGG - Intergenic
904138483 1:28332646-28332668 GAATAGAAGGAGATGATGTTTGG + Intronic
904346646 1:29876716-29876738 GAGAAGAAGCAACTGAGGTTTGG + Intergenic
904672032 1:32173206-32173228 GAGAACAATGGGCGGAGGTTGGG - Exonic
904808297 1:33146884-33146906 GAGAAGATGGGGATGAGGGTTGG + Exonic
905249972 1:36642080-36642102 TAGAGAAAGGAGATGAGGCTGGG + Intergenic
905781691 1:40716424-40716446 GAGCATAAGGAGATGAGTTAAGG + Intronic
905818604 1:40971661-40971683 GTCAACAAGCAGATGAGCTTGGG - Intergenic
906163721 1:43670064-43670086 GAGAAATAGGAGATGATGTAGGG + Intronic
907273983 1:53306858-53306880 GTAAACCAGGAGATGAGGTGAGG - Intronic
907639656 1:56174581-56174603 GAAAACAAAGAGAGGAGTTTGGG - Intergenic
907943058 1:59107545-59107567 ATGACCAAAGAGATGAGGTTTGG - Intergenic
909177797 1:72381943-72381965 GAGAACTAGGTGATATGGTTTGG - Intergenic
909469303 1:76008840-76008862 GAGAAAAAGGAAATGAGGGTGGG - Intergenic
910272353 1:85410342-85410364 GAGAAAAAGGAAATGAGGCCGGG + Intronic
911057203 1:93719158-93719180 GAGAACCTGGAGATGAGAGTGGG - Intronic
911935069 1:103960088-103960110 GTGAACAAGGAGGTGAATTTTGG + Intergenic
912180226 1:107210165-107210187 GAGACCAAGCAGAGGAGTTTGGG + Intronic
912470373 1:109902604-109902626 GAGATCAAGGATATGAGGAGAGG - Intergenic
912522405 1:110254647-110254669 GGGAACAAGGAGATGAGTTGGGG + Intronic
912674625 1:111667227-111667249 GAGAAACAGGAGAGGAGGGTAGG - Intronic
912933646 1:113984785-113984807 GAGAACAAGGAGGGGAGCTTAGG - Intergenic
912972742 1:114299380-114299402 GACGACAAGGAAATGAGATTAGG - Intergenic
913304781 1:117416721-117416743 AAGAACAATGGGAAGAGGTTGGG + Intronic
913557032 1:119977782-119977804 GTGAATTTGGAGATGAGGTTGGG + Intronic
915253171 1:154605080-154605102 GAGATCCAGGAGATGAGGCCAGG - Intronic
915676451 1:157536634-157536656 GAGAACCACAAGATAAGGTTGGG - Intronic
915727984 1:158032326-158032348 GGGAGCAGGGAGATGAGGTTGGG + Intronic
917223609 1:172758389-172758411 GAGTTCAGGGAGATGAGGATGGG + Intergenic
919682496 1:200449822-200449844 GAAAATGAGGGGATGAGGTTAGG - Intergenic
919737748 1:200963873-200963895 GAGATGCAGGAGATGGGGTTTGG + Intergenic
920133065 1:203747603-203747625 GAGGACAGGGAGATGATGCTGGG - Intergenic
921046020 1:211478716-211478738 CAGAACCAGGAGATGAGGATGGG + Exonic
921514031 1:216067729-216067751 GAGAAGCAAGAGTTGAGGTTTGG + Intronic
922076202 1:222247411-222247433 GAAAACAAAGGGATGAGGTTAGG + Intergenic
922528884 1:226327821-226327843 GAGAACAGGGAGCTGAGGACTGG - Intergenic
922976210 1:229785548-229785570 GAGGACAAGGAGATAACCTTGGG + Intergenic
923051639 1:230394572-230394594 GAGCACAAGGAGAGGAGGGGAGG - Intronic
923338311 1:232988080-232988102 GAGAAAAAGGAGAGGAGGAAAGG + Intronic
924363905 1:243269266-243269288 GAGAACAAGGGAATGAGGCTGGG + Intronic
924535022 1:244928163-244928185 CAGAAGATGGAGCTGAGGTTTGG + Intergenic
924928098 1:248703101-248703123 GAGAACAAGGAGGTGAAGATGGG - Intergenic
1063079848 10:2755988-2756010 GAGAACCGGGAGAGGAGGTAGGG - Intergenic
1063079862 10:2756052-2756074 GAGAACTGGGAGAGGAGGTAGGG - Intergenic
1063222043 10:3978049-3978071 GAGAGGAAGGAGAGGAGGTCTGG - Intergenic
1063615242 10:7594729-7594751 GAAACCAAGGGGATGGGGTTAGG + Intronic
1064122912 10:12634902-12634924 CAGCACAAGCAGATGAGGCTTGG + Intronic
1064142355 10:12801111-12801133 GAGAAGGAGGAGATGGAGTTGGG + Intronic
1065645190 10:27826650-27826672 GAGGGCAAGGAGATGAGCCTGGG - Intronic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1066637114 10:37514737-37514759 GTGAACAAAGAGATGTGGATAGG + Intergenic
1067852687 10:49764332-49764354 GAAAAAAAAGAGGTGAGGTTGGG - Intergenic
1068226617 10:54114868-54114890 GAGAAGTAGGAGATGAGGTCAGG + Intronic
1068270386 10:54716059-54716081 GAGAACCAGGAGATGTGCCTAGG - Intronic
1069054675 10:63832223-63832245 GAGAAGAAAGATATGAGGCTGGG + Intergenic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1070494460 10:77009102-77009124 GAGATGAAGAAGCTGAGGTTGGG + Intronic
1070800208 10:79240769-79240791 GAGAACAGGGAGATGGGGTAGGG + Intronic
1071052334 10:81466227-81466249 GAGAAGAATGAAATGAAGTTCGG + Intergenic
1071726028 10:88199049-88199071 GAGAAGGAGGAAATGAAGTTGGG + Intergenic
1072063222 10:91838208-91838230 GATAAAGAGGAGATGAAGTTGGG + Intronic
1072741165 10:97910775-97910797 GAGGCCAGGGAGATGAGGTGGGG + Intronic
1073494234 10:103876835-103876857 GAGAAGAAGTAGATGAGGCTGGG - Intergenic
1074214850 10:111374266-111374288 CAGAACTAGGAGATTATGTTAGG + Intergenic
1076190306 10:128478652-128478674 CACAAGAATGAGATGAGGTTGGG - Intergenic
1076750287 10:132538807-132538829 GGGAACAGGGACAGGAGGTTGGG - Intronic
1077723345 11:4648963-4648985 GAGAAGGATGAGATGATGTTTGG - Intronic
1077730011 11:4720619-4720641 GGGAACAAAGAGAAGAGTTTGGG + Intronic
1077948007 11:6923742-6923764 GAGAAGGAGGAAATGAGGTATGG + Intergenic
1078009838 11:7564397-7564419 CACAATAAGGAGATGAGGTATGG + Intronic
1078168120 11:8908341-8908363 GAGACAAATGAGATGAGGTGTGG + Intronic
1078329867 11:10410344-10410366 CAGAACAAGGAGGTAAGGGTAGG + Intronic
1078362094 11:10676923-10676945 GAGGACAGGGAGATGAGCTGTGG - Intronic
1078641838 11:13104144-13104166 AAGAAGAAGGAGAGGAGGATAGG + Intergenic
1078729336 11:13961676-13961698 GAGAACAAGGAAGTGGGGGTGGG - Intergenic
1078929034 11:15899281-15899303 CAGAACATGGAGAGGAGTTTGGG + Intergenic
1079973720 11:27066848-27066870 AAGAAAAAGGAGATGATTTTTGG - Intronic
1080171340 11:29306649-29306671 GAAAAAGAAGAGATGAGGTTAGG - Intergenic
1080308151 11:30858935-30858957 GAGAACAAGAAGCTGAAGGTAGG - Intronic
1083332727 11:61906455-61906477 GAGGGCAAGGAGGTGAGGGTGGG - Exonic
1084852698 11:71955714-71955736 GAGAAGAAGAAGAAGAGTTTTGG + Intronic
1087306861 11:96499348-96499370 GAGAACAAGGGAATGGGGCTGGG - Intronic
1087443928 11:98222005-98222027 AAGAACAAGGAGGTGGGGTGCGG - Intergenic
1087935198 11:104025739-104025761 GAGCACAGGGAGATGAGGCAGGG + Intronic
1089261268 11:117225535-117225557 GACAAGAAGGAAATGGGGTTGGG - Intronic
1089785963 11:120907365-120907387 GAGGACAAGGAGAGGAGTCTGGG + Intronic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1091801695 12:3328595-3328617 GAGAACAATGTGAGCAGGTTGGG - Intergenic
1092508314 12:9127045-9127067 GAGAACAAGGAACTGAGATTAGG - Intergenic
1092970170 12:13686313-13686335 GAAAAGAAGGAAATGGGGTTTGG - Intronic
1093499295 12:19793713-19793735 GTGAACAAGGAGAGGAGGTAGGG + Intergenic
1094062738 12:26332254-26332276 GTGAGCCAGGAGATGAGGCTGGG - Intergenic
1094371160 12:29739232-29739254 GAGCAGTGGGAGATGAGGTTGGG - Intronic
1095307993 12:40660902-40660924 GAGAAGAAAGAGATAGGGTTTGG + Intergenic
1095642833 12:44504475-44504497 GAGAACAAACAGGTGGGGTTGGG - Intergenic
1096200229 12:49676152-49676174 GAGGAGGAGGAGAAGAGGTTGGG - Intronic
1096872073 12:54599236-54599258 GAGCGGAATGAGATGAGGTTGGG + Intergenic
1097630295 12:62052495-62052517 GAGCACAAAGAGAAGAGGGTTGG - Intronic
1097757371 12:63421734-63421756 AAGTACAAGGAGTTGAGGTTAGG - Intergenic
1098935731 12:76477099-76477121 GGAACCAAGAAGATGAGGTTTGG - Intronic
1100053686 12:90483026-90483048 GAGAACAGGGAGATCACCTTGGG - Intergenic
1100860613 12:98802067-98802089 GAGAACAAAGAACTGAGTTTTGG - Intronic
1102432915 12:112897644-112897666 GAGAGCAAGGGGGTGAGGCTAGG - Exonic
1102963698 12:117110843-117110865 GAGCACAAGGAACTGAGGCTTGG + Intergenic
1103206984 12:119137556-119137578 AGGAACAAGGAGATGAGGCGAGG + Intronic
1105774414 13:23644261-23644283 GGGAACTACGAGATGAGATTTGG - Intronic
1105977212 13:25482582-25482604 AAGAAGAAGGTGATGTGGTTTGG + Intronic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1107768619 13:43765303-43765325 GAGTACAGGAAGATGAGGCTTGG - Intronic
1107902766 13:45034399-45034421 TAGAACAAGTAGTTGAGGATGGG + Intronic
1108098124 13:46926225-46926247 AATAACAAGGAGATGAGAATTGG + Intergenic
1108605468 13:52033500-52033522 GAGAACAAGGAGACTATGTGAGG - Exonic
1108913613 13:55582948-55582970 GAGCACAGAGATATGAGGTTGGG + Intergenic
1109183882 13:59246818-59246840 GAGGATTAGGAGAAGAGGTTAGG + Intergenic
1110321120 13:74161031-74161053 GAGAACACGGAGATTGGTTTTGG + Intergenic
1110340660 13:74386054-74386076 GAGAGCTCCGAGATGAGGTTTGG + Intergenic
1111554420 13:89861855-89861877 GAAAACAGAGAGATGAGATTTGG + Intergenic
1112236358 13:97641459-97641481 GTGAACAAGAAGATGAGGCCAGG - Intergenic
1112262992 13:97894729-97894751 GAGAACCAGGAGCTGGGGCTGGG + Intergenic
1112697038 13:101961571-101961593 GAGAACTACAAGATGAGATTTGG - Intronic
1114019186 14:18461560-18461582 CAGAACACTGTGATGAGGTTTGG - Intergenic
1114446822 14:22794992-22795014 GAGAAGAATGAGATGAGAATTGG - Intronic
1114767444 14:25390119-25390141 GAGAGAAAGGAAATGAGGATGGG + Intergenic
1115119996 14:29927661-29927683 GAGGGCAAGGGGATGAGGATCGG + Exonic
1115878586 14:37890049-37890071 GAGGAGCAGGAGATGAGGTCAGG + Intronic
1116388047 14:44357065-44357087 GAGAACTACAAGATGAGATTTGG - Intergenic
1116938282 14:50764972-50764994 GAAAACAAGTGGATGAGGCTGGG + Intronic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118203686 14:63701616-63701638 GAGAGCAAGTAGAAGAGGTTAGG + Intronic
1119728345 14:76935775-76935797 GAGAGCCAGCAGATGAGCTTGGG + Intergenic
1120639264 14:86990332-86990354 GAGAAATAAGAGATGAGGTGAGG - Intergenic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1121927033 14:97936941-97936963 GAGAATTAAGAGATGAAGTTAGG - Intronic
1122010695 14:98744382-98744404 GAGAAAAAGAAGATGAGGACTGG - Intergenic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1124715083 15:32052216-32052238 GAGAACAATTAGAAGAGCTTGGG - Intronic
1124791267 15:32729594-32729616 AATAACAAGGAGGTGAGGTGAGG - Intronic
1125131700 15:36290305-36290327 GAGCACAGAGATATGAGGTTGGG + Intergenic
1125157583 15:36606380-36606402 GAGAATAAGGGAATGAAGTTTGG + Intronic
1126729887 15:51672043-51672065 TAGAACAAGGTCATGGGGTTTGG + Intergenic
1126892053 15:53217120-53217142 GAGATCAAGGATTTGAGGTAGGG + Intergenic
1128596805 15:68959498-68959520 GAGAAAAAGGTGATGGGGGTGGG + Intronic
1129170880 15:73807185-73807207 GAGAAAAAGAAGAGGAGGTGAGG + Intergenic
1129243128 15:74263432-74263454 GAGAACAAGGAGATCTGTCTAGG - Intronic
1129649966 15:77478166-77478188 GAGAATAGGGAGATGAGGTGGGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130978022 15:88792176-88792198 GAGATGAAGGAGATGAGGGGAGG + Intergenic
1131044875 15:89306239-89306261 GTGAGCCAGGAGATGAGGATGGG + Intronic
1131139883 15:89968304-89968326 GAGAAGGAGGAGGAGAGGTTGGG + Intergenic
1131223935 15:90608235-90608257 GAGAGCAAGATGATCAGGTTTGG - Intronic
1131287546 15:91074295-91074317 GAGCACAAGGGAATGAGGTAGGG - Intergenic
1131800276 15:96061288-96061310 GAGAAAAATGAGCAGAGGTTAGG - Intergenic
1132073325 15:98798674-98798696 GAGGAGGATGAGATGAGGTTGGG + Intronic
1135532979 16:23270358-23270380 AAGAGGAAGGAGTTGAGGTTTGG + Intergenic
1135544450 16:23356327-23356349 TAGAACAAGGCTATGAGGCTGGG + Intronic
1135666682 16:24341624-24341646 TAGAAGAAGGAACTGAGGTTTGG + Intronic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1137031173 16:35526167-35526189 GAGAACAAGGAGACGAACTGTGG + Intergenic
1137511596 16:49105585-49105607 GGTGACAAGGAGATGAGGTGAGG + Intergenic
1137603071 16:49769677-49769699 GAAAGGAAGGAGGTGAGGTTGGG - Intronic
1138024293 16:53510849-53510871 GAGTACATGGAGATGAGGGGTGG + Intergenic
1139429206 16:66902061-66902083 GAGAAGAGGGGGATGAGGGTAGG - Intergenic
1140327966 16:74024095-74024117 CAGCAAAAGGAGATGAGCTTGGG + Intergenic
1141260439 16:82448805-82448827 GAGAAGCAGGAGTTGAGGTCAGG - Intergenic
1141702556 16:85649178-85649200 GAGAATAAGGACATTAGGGTGGG - Intronic
1142051284 16:87959819-87959841 GAGAGCAGGGCGATGAGGGTGGG + Intronic
1142591837 17:1009700-1009722 AAGAGGAAGGTGATGAGGTTGGG + Exonic
1143767346 17:9146370-9146392 GAGAACAATGAGATGAGCTCAGG - Intronic
1143953811 17:10653655-10653677 GAGAAAAAGGAGGTGAGGACAGG - Intronic
1146234952 17:31150531-31150553 GGGAAAAAGGAGATGAGGAAAGG - Intronic
1146700211 17:34951534-34951556 GAGCACAGGGAGAGGAGGTGAGG - Intronic
1147599658 17:41738068-41738090 GAGAAGACAGAGATGAAGTTAGG + Intergenic
1147877331 17:43631013-43631035 AAGAAGAAGAAGATGAGGTGTGG - Intergenic
1149577091 17:57721894-57721916 GAGAACAATGAGATCAAGGTGGG + Intergenic
1150937004 17:69647562-69647584 GATTACAATGAGATGAGATTTGG - Intergenic
1151560262 17:74866120-74866142 GAGAACCAGGAGGTGAGTATGGG - Exonic
1151568909 17:74916303-74916325 GAGAACAGGGAGAAGAGCTGTGG + Exonic
1152413726 17:80145678-80145700 GAGAGCCTGGAGAAGAGGTTGGG - Intronic
1152519304 17:80845971-80845993 GAGACCAAGGAGATGAGCTGGGG - Intronic
1153642141 18:7166305-7166327 GAGCACAAGGAGGTGAGGACAGG - Intergenic
1153919479 18:9775587-9775609 GAGATCAAGGAAATGACCTTAGG - Intronic
1155554945 18:27008262-27008284 GAGGAGAAGAAGATGGGGTTGGG + Intronic
1156867700 18:41907356-41907378 CAGAAGAAGAAGGTGAGGTTGGG - Intergenic
1156948146 18:42860309-42860331 GAGAAGAAGGAGATGGGAATGGG + Intronic
1157491838 18:48129020-48129042 CAGAACGAGGGGATGAGGTGAGG + Intronic
1157775589 18:50393357-50393379 AAGATCAAGCTGATGAGGTTAGG + Exonic
1158696784 18:59710581-59710603 GAGGAGATGGAGATGAGGCTGGG - Intergenic
1159280728 18:66281156-66281178 GAGAACAAAGAAGTGAGGTAGGG - Intergenic
1160090932 18:75826003-75826025 GAGGAGCAGGAGATGAGGTCAGG - Intergenic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161658852 19:5533538-5533560 GAGGGGAAGGAGATGAGGTCAGG + Intergenic
1162838332 19:13336537-13336559 AAAATCAAGGAGAGGAGGTTGGG + Intronic
1163013572 19:14440417-14440439 GGGAACAAGGAGAGGAGATGGGG + Intronic
1163473494 19:17511688-17511710 GAGAACACCGAGATGAGGCCCGG - Exonic
1163486704 19:17591944-17591966 AAGAACAATGAGGTCAGGTTAGG + Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164740904 19:30575038-30575060 GACAACAAGGAGTGGAGGTAAGG - Intronic
1165387504 19:35519467-35519489 AAGAACAGGGAGAGGAGTTTGGG - Intergenic
1166056458 19:40292455-40292477 GTGCACAAGGAGGTGAGATTTGG - Intergenic
1166515924 19:43446910-43446932 GAGAGCAGGGAGATGAGGCTGGG - Intergenic
1166683017 19:44779457-44779479 GTGACCAGGCAGATGAGGTTTGG + Intronic
1167395470 19:49225613-49225635 GAGAACAAGGGTGTGAGGCTGGG - Intergenic
1167583048 19:50357770-50357792 GAGAAACAGGAGATGAGATCCGG + Intronic
1168418444 19:56184439-56184461 TTGAAGAAGGAGATGGGGTTGGG - Intronic
1168557247 19:57353384-57353406 GAGAAGATGGAGCTGAAGTTTGG + Intronic
925229123 2:2215996-2216018 GAGAAAGAGGAGAGAAGGTTGGG - Intronic
925746948 2:7051493-7051515 GAGGGCCAGGACATGAGGTTAGG + Intronic
926234231 2:11027409-11027431 GTGAAGAAGGAGGGGAGGTTCGG - Intergenic
927165789 2:20319914-20319936 AAGAACAAGGAGATGAATTTTGG + Intronic
927287292 2:21369908-21369930 GGGAACAAGGAAATGAAGTGAGG - Intergenic
927688672 2:25191658-25191680 GAGAGGCAGGAGATGAGGTTAGG + Intergenic
927932854 2:27056641-27056663 GAATTCAAGGAGATGAGCTTTGG - Exonic
928722862 2:34140774-34140796 GAGAACAAAGAGAAAAGGCTAGG + Intergenic
928977776 2:37106746-37106768 TAGAACAAAGAGATGAGGCTGGG + Exonic
929607092 2:43241917-43241939 GAGACCACTGAGATGAGGTTTGG - Intronic
930025656 2:47027778-47027800 GAGAACGAGGAGATGACGTAAGG + Intronic
930099969 2:47595972-47595994 GAGAACAGGGAGGTGATGTGAGG - Intergenic
931252893 2:60549734-60549756 GTGAAAAAGGAAGTGAGGTTTGG + Intronic
932440550 2:71731892-71731914 GAGAGCCAGGAGATGAGGTGTGG - Intergenic
932463898 2:71901042-71901064 GAGAACCAGGAGTTGATATTTGG + Intergenic
932623596 2:73281892-73281914 GAGACCAAGGGCATGAGCTTTGG - Intronic
932883332 2:75524483-75524505 GAGAGCAAGCAGGTGAGGGTTGG - Intronic
933492257 2:83000760-83000782 GAGAAGAAGGAGATAACGTAGGG + Intergenic
935374083 2:102377716-102377738 GTCAAAAAGGAGATGAGGTGAGG - Intronic
935527525 2:104189467-104189489 GAGTACAAGGATCTGAGTTTGGG - Intergenic
936404287 2:112188320-112188342 GAGAACACAGAGGTGATGTTTGG + Intergenic
937818087 2:126275691-126275713 GAGAGGAAGGAGCTGAGTTTGGG - Intergenic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939582918 2:143972473-143972495 AAGTAAAAGTAGATGAGGTTTGG + Intronic
939803512 2:146743390-146743412 GACATCTAGGAGATGTGGTTAGG - Intergenic
940323957 2:152405402-152405424 CAGAACAAGGACAGGATGTTGGG - Intronic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
940791423 2:158033552-158033574 GGGAAGAAGGAGAAGAGGCTGGG + Intronic
941459493 2:165752117-165752139 GAGGACTAGGAAATGAGGTCGGG - Intronic
941771375 2:169349431-169349453 GAGGAGAAGGAAATGAGGTCAGG + Intronic
942985057 2:182131135-182131157 GAAAACAAGGAGATTAATTTTGG - Intronic
943104547 2:183528501-183528523 GGGAACTATGAGATGAGATTTGG - Intergenic
943957750 2:194214649-194214671 GAGAACATGGTGATATGGTTCGG + Intergenic
944512388 2:200477476-200477498 GAAAACATGAAGATGAGGTCAGG - Intronic
945220890 2:207483236-207483258 AATAACTAGGAGATGAAGTTTGG + Intergenic
945301986 2:208223031-208223053 GAGAACCATGAAAGGAGGTTAGG - Intergenic
945425954 2:209702354-209702376 TAGAACAAGGATATGGGATTAGG - Intronic
947095140 2:226558135-226558157 GATAAAAAGGAAATGAGGTGTGG - Intergenic
1169350774 20:4866455-4866477 GAGCACAGGGAGATGAGGGAAGG - Intronic
1169587720 20:7104615-7104637 GAGGACCATGAGATTAGGTTTGG + Intergenic
1169634606 20:7674943-7674965 GAGAAAAAAGAGATCAGGTCTGG + Intergenic
1169730035 20:8776876-8776898 GAGAATAAGGAGGGGCGGTTTGG + Intronic
1169834924 20:9867541-9867563 GAGAAGAAGGGGATGAAGATTGG - Intergenic
1170034145 20:11972353-11972375 GAGAAGAAGGAGAGGACATTGGG + Intergenic
1171041796 20:21770869-21770891 GAGGGCATGGAGATGAGGTGGGG + Intergenic
1172351030 20:34240946-34240968 GAAAGCAAAGAGATGAGGTGGGG + Intronic
1173408500 20:42788485-42788507 CAGGCCAAGGAGATGAGGCTGGG + Intronic
1173959652 20:47061152-47061174 GAGAGTAAAGAGATGAAGTTGGG - Intronic
1174408421 20:50318019-50318041 GAGAAAAGGGAGAGGAGGTATGG + Intergenic
1174786708 20:53439536-53439558 GGGAACAAGGAGATAAGGACAGG + Intronic
1175980549 20:62736472-62736494 GGGAACCAGGAGAGGGGGTTTGG + Intronic
1178715756 21:34962981-34963003 GAGAACAAAGTGCTGATGTTGGG - Intronic
1179078508 21:38147378-38147400 GAGAACAAGTAGCAGATGTTGGG - Intronic
1180443689 22:15392384-15392406 CAGAACACTGTGATGAGGTTTGG - Intergenic
1180516733 22:16151478-16151500 GAGAAAATGGAGATTATGTTAGG - Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1180890024 22:19280913-19280935 GACAAAAAGTAGATGGGGTTGGG + Intronic
1180935156 22:19620619-19620641 AAGAAAAAGGAGAGGAGATTAGG + Intergenic
1181491482 22:23263086-23263108 AAGGACAAGGAGGTCAGGTTTGG + Intronic
1182788326 22:32926973-32926995 GAGAACAAGAATATGGGCTTGGG + Intronic
1182960912 22:34474419-34474441 GAGATGAAGGAGCTGAGGCTTGG + Intergenic
1183305133 22:37078854-37078876 GAGAAGAAGGAGAAGAGGAAGGG + Intronic
1183313544 22:37124754-37124776 GAGAAAAAGGAGGAGAGGTGGGG - Intergenic
1183563840 22:38598465-38598487 GAGAACAATGAAGTGATGTTTGG + Intronic
1184377832 22:44125656-44125678 GAGAGCCAAGAGATGAGGCTGGG + Intronic
1184882943 22:47323047-47323069 GGGAGCCAGGAGATGAGGTCAGG + Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
950002924 3:9671142-9671164 GAGAACAAGAAGGTGAAGTTTGG + Exonic
951164809 3:19472349-19472371 GAGAACTACAAGATGAGATTTGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951323534 3:21275853-21275875 GAGACCCAGGAGGTGATGTTAGG - Intergenic
951622808 3:24624975-24624997 GACAACAAGGTGATATGGTTTGG + Intergenic
951912106 3:27761617-27761639 GGAAACAAAGAGATGTGGTTAGG + Intergenic
951940422 3:28071889-28071911 GAGAAGAAGGAAATGGGTTTAGG + Intergenic
952850619 3:37725517-37725539 GAGAACATGCAGAGGAGCTTTGG + Intronic
953210852 3:40873696-40873718 GAGAGCAAGGAGATAAGGAAAGG + Intergenic
953679252 3:45027217-45027239 GAGTCCAAGGGGATGAGGGTGGG + Intronic
955211032 3:56941093-56941115 GAGAACTGGGAGAGGAGGTGGGG + Intronic
955476308 3:59340048-59340070 GAGAACAAGAAGAAGAGATGTGG + Intergenic
955599960 3:60634699-60634721 GAGAAAGAGGAGAAGAAGTTTGG + Intronic
955631879 3:60983283-60983305 GAGAAGAAGGAAATGAGGAAGGG + Intronic
955876494 3:63495321-63495343 GGGAAGAAGGAGATGAGCTGAGG + Intronic
956235488 3:67066150-67066172 GAAAAAAAGGATATGAGGCTGGG + Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
956871069 3:73418704-73418726 GAGAACAAGAAAATGAAGTCAGG - Intronic
957679956 3:83421146-83421168 GATAACAAGTAGAAGAGCTTGGG + Intergenic
958618257 3:96524493-96524515 GAAAACAATTGGATGAGGTTGGG - Intergenic
958636858 3:96755850-96755872 TAGAACAAGGAGTTGGGGTAGGG + Intergenic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
959867239 3:111284831-111284853 GAGATCAAGGAGATGAATTTTGG - Intergenic
960447805 3:117769028-117769050 GAGAGAAAGGATATGTGGTTTGG - Intergenic
961692356 3:128679287-128679309 GAAAACAAAGAGAAGAGGGTTGG - Intronic
961855253 3:129863941-129863963 GAGAACAAGGACATGGCATTTGG - Intronic
962511908 3:136110102-136110124 GAGAACAGGGATATGAGTTGGGG - Intronic
964335738 3:155652643-155652665 GAGAACAAGTAAATGAGATGAGG - Intronic
964391984 3:156207243-156207265 GAGAAGAAGAAAATGTGGTTGGG + Intronic
964514174 3:157489261-157489283 GTGGAAAGGGAGATGAGGTTAGG - Intronic
965620017 3:170633816-170633838 GGGAAGAAGCAGATGAGGCTGGG + Intronic
965835457 3:172846561-172846583 GATTACAAAGAGATGAGATTTGG + Intergenic
965910287 3:173766382-173766404 GAGGAAAAGAAGATGAGGCTGGG - Intronic
966028509 3:175316317-175316339 GAGAAAATGTAGATGAGGGTGGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967356075 3:188573347-188573369 GAAAAATAAGAGATGAGGTTTGG + Intronic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
968628523 4:1638554-1638576 GGGAAGGAGGAGATGAGGTAGGG + Intronic
970815731 4:20154206-20154228 TAGATGAAGGAGATGAGGCTTGG - Intergenic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
970952030 4:21767420-21767442 GAAATCAAGGAGATGGGGTTAGG + Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
972158753 4:36197943-36197965 GAAAACAAGGAGAAGAGCTGCGG - Intronic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
972578639 4:40375294-40375316 GAGCAGCAGGAGATAAGGTTAGG - Intergenic
972809487 4:42566483-42566505 GAAACCAAGTGGATGAGGTTGGG + Intronic
973312512 4:48724608-48724630 GTGACCCAGGAGATGATGTTGGG - Intronic
973876618 4:55226394-55226416 GAGAGCAAATAGATGAGCTTAGG + Intergenic
973900587 4:55466089-55466111 GGGAACAACAAGATGAGATTTGG - Intronic
973927051 4:55749153-55749175 AAGAAAGAGGAGATAAGGTTGGG + Intergenic
974642670 4:64651926-64651948 GAGAACATGAAGATAAGATTGGG + Intergenic
974733719 4:65900962-65900984 GAGAACTACGAGATGAGATTTGG - Intergenic
975997071 4:80328135-80328157 GAGAACAGGGAAATGAGGAAGGG + Intronic
976704312 4:88005947-88005969 GAAAACAAGGTCATGAGGGTAGG + Intergenic
977481435 4:97582118-97582140 CAGAAGTAGGAGATGGGGTTGGG - Intronic
978059379 4:104317584-104317606 GAGAGCTAGAAGATGAGATTTGG - Intergenic
979708601 4:123750599-123750621 GAGAGCAATGAGATGAGGAGAGG - Intergenic
980055599 4:128076298-128076320 GAATACAACGAGATGAGGCTGGG - Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
983019710 4:162660291-162660313 GAGAATAAGTAGCTGAGGTTAGG - Intergenic
983813888 4:172098666-172098688 GTGAACAAGGAAATCAGCTTGGG + Intronic
983990099 4:174108045-174108067 GAGTACAAGGAGAAGAGAATAGG + Intergenic
986190021 5:5487791-5487813 GAGAAGGAGGAGCTGATGTTGGG + Intronic
986539361 5:8827873-8827895 GAACACTAGCAGATGAGGTTTGG + Intergenic
987294716 5:16539539-16539561 GAGCAGGAGGAGATGAGGCTGGG - Intronic
988434985 5:31163743-31163765 GAGCATAAGGAGGCGAGGTTTGG + Intergenic
988863677 5:35310892-35310914 TAGAACAAGTAAATTAGGTTTGG + Intergenic
989712642 5:44418462-44418484 GAGAATAAGGACATGAAATTTGG + Intergenic
990791447 5:59484524-59484546 GAAAATAAGGAAATGAGGTCTGG - Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992385409 5:76279829-76279851 GAGAACATGACGATGAGGGTTGG + Intronic
992595717 5:78345452-78345474 GAGAACAGAGAGAAGGGGTTAGG - Intergenic
992678182 5:79126763-79126785 GAGACCAAGCAGATGAAGTGAGG + Intronic
993158621 5:84259284-84259306 GACAACCAGTAGAAGAGGTTAGG + Intronic
993572101 5:89553866-89553888 ATGCACCAGGAGATGAGGTTCGG - Intergenic
994983695 5:106907926-106907948 GAGAAATAGGAGGTGAGGTCAGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
998512622 5:142725914-142725936 GAGATCAAGGAGTTTAGGTTGGG + Intergenic
998635457 5:143949721-143949743 GAGTAGGAGGAGATGAGGTTGGG - Intergenic
999363220 5:151003705-151003727 GAGAACAAGGAGACTAGTTAGGG + Intergenic
999714437 5:154348606-154348628 GAGAACAAGTAGACAAGCTTTGG + Intronic
999744092 5:154578387-154578409 GAGCACAGGGAGACCAGGTTGGG + Intergenic
999827036 5:155283422-155283444 GAGACAGAGGAGATGAGGCTTGG + Intergenic
1001777334 5:174338453-174338475 GAGAACAGGGAGAGGAGTGTGGG - Intergenic
1001818426 5:174690755-174690777 CAAAACAAGGGGATGAGGGTGGG - Intergenic
1002064072 5:176643521-176643543 GCGAACTGGGAGATGAGATTTGG - Intronic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006291720 6:33143026-33143048 GTGAGGAAGGACATGAGGTTTGG + Intergenic
1006299604 6:33186521-33186543 GGGAATAGGGAGATGAGGGTGGG + Intronic
1006828826 6:36956502-36956524 GAGGAGGAGGAGATGAGGCTGGG + Intronic
1006938844 6:37738026-37738048 GAGTACAGGGAGATGAGGGATGG + Intergenic
1007515097 6:42404634-42404656 GAGGATAAGGAAATGAGGTTGGG - Intronic
1008964253 6:57298459-57298481 GAGAACAAAGAGATGAGGAGTGG + Intergenic
1008970864 6:57366433-57366455 AAGGACATGGAGATGTGGTTGGG + Intronic
1009159826 6:60268235-60268257 AAGGACATGGAGATGTGGTTGGG + Intergenic
1009827914 6:68891272-68891294 GGGAGCTACGAGATGAGGTTTGG + Intronic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1010493888 6:76509001-76509023 GAACACAAGGTGATGAGGTCAGG - Intergenic
1010976974 6:82326141-82326163 GAGAACAAAGAGAACAGGGTGGG - Intergenic
1011047331 6:83099041-83099063 GAGAAAAAGGAGATGAGAAGAGG + Intronic
1011325570 6:86147450-86147472 GAGATAAAGGAAATGAGTTTTGG - Intergenic
1012429310 6:99147657-99147679 GAGCACAGGCAGAAGAGGTTTGG + Intergenic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1013821384 6:114157198-114157220 GGGAACAGGGAGAAGAGGATGGG - Intronic
1013835079 6:114325186-114325208 AAGACCAAGTTGATGAGGTTTGG - Intronic
1015582928 6:134746009-134746031 GAAAACAGGGAGAGGAGGCTGGG + Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1017991736 6:159494937-159494959 AAGAATTAGGAGATGAGGTGGGG - Intergenic
1020472555 7:8555649-8555671 ACGAACAAAGAAATGAGGTTGGG - Intronic
1021067032 7:16188323-16188345 GTGAGCAAAGAGATGAGGTGAGG + Intronic
1022060777 7:26792298-26792320 GTGAACAATGTGATGAGTTTTGG - Intronic
1022242845 7:28529640-28529662 TAGAGCAAGGAAATCAGGTTGGG - Intronic
1022513949 7:30963798-30963820 GAGTAGAAGGCGATGAGGGTGGG + Intronic
1022909668 7:34888464-34888486 GAGTAGTACGAGATGAGGTTTGG + Intergenic
1023445013 7:40222358-40222380 GAGAACACAGAGAAGAGGTATGG - Intronic
1023580673 7:41679370-41679392 TAAAGCAAAGAGATGAGGTTTGG - Intergenic
1023939484 7:44760560-44760582 GAGTGCAAGGAGTTGAGGTTGGG - Exonic
1024173618 7:46815280-46815302 GAGAACACTGAGGGGAGGTTGGG - Intergenic
1024896997 7:54271846-54271868 GAGAACAAGGAGCTAAAGTGTGG + Intergenic
1026073106 7:67140255-67140277 AAGAACAAGGTGATATGGTTTGG - Intronic
1026703779 7:72671959-72671981 AAGAACAAGGTGATATGGTTTGG + Intronic
1027586236 7:80062229-80062251 GAGAGCTACGAGATGAGATTTGG + Intergenic
1028658205 7:93235249-93235271 GAGTAGTGGGAGATGAGGTTAGG + Intronic
1029492504 7:100879828-100879850 AAGAAGAAGAAGATGAGGATGGG + Intronic
1030226058 7:107152276-107152298 GAGCAGTAGGAAATGAGGTTGGG - Intronic
1031123541 7:117747782-117747804 AAGAAAAAAGACATGAGGTTTGG + Intronic
1033807398 7:144970263-144970285 GAGAACAGGGAGAGGACTTTGGG + Intergenic
1034274191 7:149816908-149816930 GAGGACAGGGAGGTGAGGCTGGG - Intergenic
1035445970 7:158943533-158943555 GAAACCTAGGAGATGAGGTCTGG + Intronic
1036182662 8:6598439-6598461 GAGAAGAAGGGGATGGGGTGGGG + Intronic
1038280034 8:26155749-26155771 GGGAAGAAGGAGATGGGATTAGG + Intergenic
1038310891 8:26445471-26445493 GAGGACAAGGAGATGAAGCGTGG + Intronic
1038912019 8:31975352-31975374 GAGAATCAGGAGGTGAGGATGGG + Intronic
1039473845 8:37829135-37829157 ATGAAAAAGGAGATGAGGTTGGG - Intronic
1039918695 8:41877933-41877955 GAGGACAGGGACAGGAGGTTGGG + Intronic
1041140807 8:54817301-54817323 GAGACAAAGAAGATCAGGTTAGG + Intergenic
1041872976 8:62656015-62656037 GGGGATAAGGACATGAGGTTTGG - Intronic
1042056887 8:64773576-64773598 CAGTATAAGAAGATGAGGTTTGG - Intronic
1042524550 8:69750504-69750526 GAGGCCTGGGAGATGAGGTTGGG - Intronic
1042993826 8:74670904-74670926 GAGAAACAGAAGAGGAGGTTAGG - Intronic
1043133449 8:76490630-76490652 GAGCAAAAGGATATAAGGTTAGG + Intergenic
1043975018 8:86574912-86574934 TAAAACAAAGTGATGAGGTTAGG - Exonic
1044181822 8:89205568-89205590 GAGAGCTACGAGATGAGATTTGG + Intergenic
1045268779 8:100644109-100644131 GGGAAAGAGGAGATCAGGTTAGG + Intronic
1046443072 8:114283082-114283104 GGGAACAGAGATATGAGGTTGGG - Intergenic
1046918826 8:119705872-119705894 GAGAATAAGGATATGATGTCTGG - Intergenic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1047719521 8:127626652-127626674 GAGAACACCAAGATGAGGTGTGG + Intergenic
1047731407 8:127731883-127731905 AAGAAGAAGGAGAGGAGGCTGGG + Intergenic
1049084917 8:140471119-140471141 GAGAGCAAGTAAATGAGGATGGG - Intergenic
1050628897 9:7538051-7538073 GAGTAGCAGGACATGAGGTTGGG + Intergenic
1050779897 9:9320298-9320320 GAGAAGAAGGTGGTGAGATTGGG + Intronic
1050890047 9:10813176-10813198 GAGTAACAGGAGATGATGTTGGG - Intergenic
1051055298 9:12978175-12978197 GAGAAGAGGGAGATGAGGTCAGG - Intergenic
1052384363 9:27806896-27806918 GAGAACAAGGAGATTTGAGTAGG + Intergenic
1052536885 9:29759322-29759344 AAGATCAAAGAAATGAGGTTGGG - Intergenic
1052864768 9:33458238-33458260 GGGAAGAAGGAGAAGGGGTTAGG + Intergenic
1053229054 9:36390363-36390385 GAAAACAAGGAGACGATATTGGG + Intronic
1053417473 9:37955840-37955862 GTGAACTGGGAGGTGAGGTTGGG + Intronic
1053705592 9:40749823-40749845 GAGAAAATGGAGATTATGTTAGG + Intergenic
1054415669 9:64873430-64873452 GAGAAAATGGAGATTATGTTAGG + Intergenic
1055074565 9:72200289-72200311 GAAAAGAAGGAGAGGAGGCTGGG - Intronic
1055700667 9:78942420-78942442 TAGAAGAAGGAAATGGGGTTGGG + Intergenic
1056027607 9:82515400-82515422 AAGAAGTAGGAGTTGAGGTTGGG - Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1056473457 9:86928800-86928822 CAGAAGAATGAAATGAGGTTGGG + Intergenic
1057790459 9:98121248-98121270 CAGCACTAGGAGATGAGCTTTGG - Exonic
1059299690 9:113302391-113302413 TAGACCAAGGAGATGACTTTGGG - Intronic
1059697654 9:116744097-116744119 CAGAAAAAGGAGGTGAGGGTGGG + Intronic
1059814631 9:117898975-117898997 GAGAACAAAAAGATGACTTTTGG + Intergenic
1060106400 9:120876199-120876221 GAGAAAAAGGAGATGGGAGTGGG - Intronic
1060440408 9:123633280-123633302 GAGAACATGGAGGTGAGGACAGG - Intronic
1060637329 9:125209649-125209671 GAGAGCCAAGAAATGAGGTTGGG - Intronic
1060834309 9:126743490-126743512 GAGAACAAGGAAGACAGGTTGGG + Intergenic
1062000588 9:134213926-134213948 CAGACCTAGGAGATGAGGGTGGG - Intergenic
1062116014 9:134809274-134809296 GAGAAGACGGAGATAAGGTAAGG + Exonic
1062627755 9:137450873-137450895 GAGATCAAGGGGAAGAGGTGTGG - Intronic
1062628048 9:137451902-137451924 GAGACCAAGGGGAAGAGGCTGGG - Intronic
1062628059 9:137451931-137451953 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062628093 9:137452059-137452081 GAGACCAAGGGGAAGAGGCTGGG - Intronic
1062628104 9:137452088-137452110 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062628122 9:137452145-137452167 GAGACCAAGGGGAAGAGGCTGGG - Intronic
1062628133 9:137452174-137452196 GAGACCAAGGGGAAGAGGTGTGG - Intronic
1062628162 9:137452259-137452281 GAGACCAAGGGGAAGAGGTTGGG - Intronic
1185935126 X:4248146-4248168 GAGATGAAGGAGGTGATGTTGGG + Intergenic
1186338061 X:8613519-8613541 GAAAACCAGCAGATGAGGCTAGG - Intronic
1186991492 X:15073877-15073899 AGGAACAAAGAGAAGAGGTTAGG - Intergenic
1187771965 X:22708924-22708946 GAGAAGAGAGAGATGAAGTTGGG - Intergenic
1189157260 X:38771132-38771154 AAAAACAAAGTGATGAGGTTAGG - Intergenic
1189213475 X:39303871-39303893 TAGAAGAAGGACATGAGATTTGG + Intergenic
1190035323 X:47018203-47018225 GGGAAGAAGGAGATGGGGTGAGG - Intronic
1190887585 X:54543174-54543196 GAGGACCAGGAGATGAGGGCAGG - Intronic
1191834265 X:65447114-65447136 GAGAAGAGGGAGATTAGATTGGG - Intronic
1192579339 X:72267944-72267966 GGGAACAGGTAGATGAGGTGAGG + Intronic
1194557126 X:95373464-95373486 GAGAACTACAAGATGAGATTTGG + Intergenic
1195491206 X:105472031-105472053 GGGAATAATGGGATGAGGTTGGG + Intronic
1198613905 X:138432592-138432614 GTGAAGAAGGTGATGAGGATAGG + Intergenic
1198762945 X:140052851-140052873 GAGAACAAGTAGAGGAGACTAGG - Intergenic
1201622607 Y:15977169-15977191 GAGAACAAGGAAAACAGATTAGG + Intergenic