ID: 1121370284

View in Genome Browser
Species Human (GRCh38)
Location 14:93351540-93351562
Sequence ACCTGTAAGCTAAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121370284 Original CRISPR ACCTGTAAGCTAAACAAGGA AGG (reversed) Intronic
902111638 1:14083931-14083953 ACCTGTGAGCAAAACAAACATGG + Intergenic
907098929 1:51809635-51809657 ACCTGTAAGCTCAACACGTTGGG + Intronic
908541759 1:65128981-65129003 ACCTGTAAGCTGGACCATGAGGG + Intergenic
908755044 1:67461881-67461903 CCTTGTAAGCTAGACAAGGCAGG - Intergenic
913226802 1:116707691-116707713 TCCTGTAACCAAAACAAGAAGGG - Intergenic
915841194 1:159214818-159214840 ACCTGTGAGCCAGGCAAGGAAGG - Intergenic
917444460 1:175095480-175095502 ACGTGTAATGTAAACCAGGAGGG - Intronic
918380743 1:183952764-183952786 CCCAGTTAGGTAAACAAGGAAGG - Intronic
918897373 1:190365914-190365936 ACCTGTAAGAAATAGAAGGAAGG + Intronic
918921208 1:190712817-190712839 ACCTGTAAGCTAAACCAAACAGG - Intergenic
920047687 1:203144195-203144217 ACATGCAGGCAAAACAAGGAAGG - Intronic
920931846 1:210395947-210395969 TACTGTAATCTAAACAAGGCAGG + Intronic
921677213 1:217990005-217990027 ACCTGTAAGCAAAATAAGCTTGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1062800333 10:374473-374495 CCCTGTCTGCTAAACAGGGAGGG - Intronic
1063238351 10:4142237-4142259 ACCTGAAATCTAAGGAAGGACGG - Intergenic
1067128034 10:43536774-43536796 ATTTCTAAGCAAAACAAGGAAGG - Intergenic
1068945890 10:62728445-62728467 CCCTGTAGGCTAAACTACGATGG + Intergenic
1070948333 10:80411172-80411194 ATCAGTATGCTAGACAAGGATGG + Intronic
1072902510 10:99421015-99421037 AGCTGTAAGTTCCACAAGGATGG - Intronic
1073743630 10:106440522-106440544 ACCAGAAAGTTAAACAAGCATGG + Intergenic
1074003253 10:109393374-109393396 ACCTGAGAGCCACACAAGGAAGG + Intergenic
1083392713 11:62366479-62366501 ACCTGTTAGATAAGGAAGGAGGG - Intronic
1083395070 11:62385134-62385156 ACCTGTTAGATAAGGAAGGAGGG - Intronic
1084079967 11:66815962-66815984 ACCTGTATTCTGAACAAAGAAGG - Intronic
1085427261 11:76415627-76415649 ACCTGAAATCTTAACAAGAATGG + Intergenic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1086901611 11:92373905-92373927 ATCTGTAAGCTGGAGAAGGAGGG + Intronic
1090916441 11:131168117-131168139 ACATGTAAGCTAAGTAAAGAGGG - Intergenic
1099619853 12:84989099-84989121 AAATGTAAGCTAAAGAAGCATGG - Intergenic
1100059652 12:90558682-90558704 AAGTGTGAGCTAAACAATGAAGG - Intergenic
1103717596 12:122954453-122954475 ACCTGTAATCTCAGCAAGGGGGG - Intronic
1106524392 13:30527305-30527327 GCCTGTCAGCTCACCAAGGAAGG + Intronic
1108621670 13:52190893-52190915 ACCTGTAAGCTAAGCTAAAATGG + Intergenic
1116781626 14:49243544-49243566 ACCACTAAGCTAAACATGCAGGG - Intergenic
1118242138 14:64070206-64070228 CCCTGTATGCTAAAAAAGTAAGG - Intronic
1121370284 14:93351540-93351562 ACCTGTAAGCTAAACAAGGAAGG - Intronic
1122103795 14:99435705-99435727 ACCTGTAGGAGAAACAAGGCAGG + Intronic
1128611265 15:69075229-69075251 ACCTGTAAGCAAAACAGAAAAGG - Intergenic
1128946659 15:71827705-71827727 ACCTGTATGCCAAACGATGAAGG + Intronic
1131003391 15:88956091-88956113 ACCTGTAATCCCAACAAGTAGGG - Intergenic
1131432754 15:92399993-92400015 ACCTGTAAGCAATACAAAAATGG - Intronic
1133895655 16:9926197-9926219 ACCTGTAAGTTGAACCAAGAAGG + Intronic
1136737907 16:32479145-32479167 ACCTTAAAGCAAAACAGGGATGG - Intergenic
1137054352 16:35736160-35736182 TCCTGGAAGCTAAACAGGGTTGG + Intergenic
1139636574 16:68261765-68261787 ACCTGTTAGCCAAACCTGGAAGG + Intergenic
1139798630 16:69503261-69503283 TCTTGGAAGCTAAGCAAGGATGG + Intergenic
1140186754 16:72780376-72780398 ATCTGTAAGGTAGACAAGGTGGG - Intergenic
1140853540 16:78956779-78956801 ACCTGTAGGGGAAACAAAGAGGG + Intronic
1141053092 16:80790625-80790647 ACCTGTAACTTTAAGAAGGAAGG - Intronic
1203015166 16_KI270728v1_random:350432-350454 ACCTTAAAGCAAAACAGGGATGG + Intergenic
1203033501 16_KI270728v1_random:623590-623612 ACCTTAAAGCAAAACAGGGATGG + Intergenic
1148277481 17:46318402-46318424 ATCGGTAAGCTAACCGAGGAGGG - Intronic
1148299688 17:46536267-46536289 ATCGGTAAGCTAACCGAGGAGGG - Intronic
1148799899 17:50217299-50217321 ACCTCTAAGGAAAAAAAGGATGG + Intergenic
1150402817 17:64873020-64873042 ATCAGTAAGCTAACCGAGGAGGG + Intronic
1150691350 17:67369827-67369849 ACCTCTAAGCTCAGCAAGGAAGG - Intergenic
1160055540 18:75476094-75476116 ACCAGAAAGCTAGACAAGGCCGG - Intergenic
1166753645 19:45177652-45177674 AAATGTAAGCTTCACAAGGAAGG + Intronic
928274265 2:29885210-29885232 ACCTGTAAGTTCAACAATGAAGG + Intronic
928540187 2:32277511-32277533 ACCTGTAAGATGAAGAGGGATGG - Intergenic
928923501 2:36551899-36551921 ACCTGTGAGCAAAACAAACAGGG - Intronic
929255110 2:39802251-39802273 ATCTGCAAGCTGAACAAGCATGG + Intergenic
930386666 2:50704900-50704922 ACCTGTGAGTTAAATAAGGCAGG + Intronic
932236104 2:70122263-70122285 ACATGAAAGCTAAAAAAGCAAGG - Intergenic
932797232 2:74706975-74706997 ACCTGGAAGCAGAACAAGGCTGG + Intergenic
933347913 2:81113069-81113091 ACCTAAAAGCTAAAAAAAGAAGG + Intergenic
935676455 2:105598522-105598544 ACCTGTCAGCAAACCAGGGAAGG + Intergenic
936249110 2:110853733-110853755 GCCTGTAAACCAAACAAGAAAGG - Intronic
937165576 2:119812913-119812935 GCCTGTATGATGAACAAGGAAGG + Intronic
939118062 2:138084162-138084184 ACCTGTAATCTCAACAATGTGGG + Intergenic
942490416 2:176484316-176484338 ACCAGCAAGCTGAACACGGAGGG - Intergenic
948360603 2:237417482-237417504 AACTGTAACCTAATCCAGGAAGG - Intergenic
948882425 2:240866793-240866815 ACCTCCTAGCTGAACAAGGAGGG + Intergenic
1175805609 20:61826897-61826919 ACCAGTAAGTTAAAAAAGCAAGG + Intronic
1184030707 22:41892780-41892802 ACCTGCAGGGTAAACTAGGAAGG - Intronic
1184349527 22:43934585-43934607 ACCTGTGAGCAAAGCAAGCAAGG - Exonic
949830728 3:8211417-8211439 AGATGTAAGCTAACCAAGGTTGG + Intergenic
951059687 3:18190645-18190667 AGCTGTGAGCTAAAAAAGGAGGG - Intronic
953355325 3:42251501-42251523 ACCTTTAGGCTCAACAAGGTAGG - Intergenic
956040291 3:65138394-65138416 ACCTGTAGGCCAAACAGGTATGG - Intergenic
956164686 3:66387470-66387492 ACCACTAAACTAAACAAGCAGGG + Intronic
956165448 3:66395117-66395139 AGCTGTGAGCTAAAGAATGATGG + Intronic
957334041 3:78803671-78803693 TCCTGTAAGCTAAGAAAGGAGGG + Intronic
957402344 3:79732847-79732869 AAATGTAAGCTAATCAAAGAGGG - Intronic
960813873 3:121653541-121653563 CCCTGTGAGGTAAACAGGGATGG + Intronic
961241823 3:125417776-125417798 ATCTGTATGCTGAACAAGCATGG + Intergenic
963490239 3:145990926-145990948 ACCTGTAAGATGAAAAAAGAAGG + Intergenic
966296404 3:178428706-178428728 AGCTTTAAGCCAAACAAGCAAGG + Intronic
966953837 3:184852486-184852508 ATCTGTAAACTAAACAGAGAAGG - Exonic
967454770 3:189672177-189672199 ACCTGTAAACTAAACATAAAAGG + Intronic
970341374 4:15110788-15110810 ACCAGTAAGATAATCAAGTAAGG + Intergenic
972298418 4:37762285-37762307 ACCTCTATGCCAAACCAGGAGGG - Intergenic
973755123 4:54066455-54066477 ACCTGTGAGGTAAGCAAAGAGGG + Intronic
975946460 4:79711254-79711276 ACCTGTAAGGGACACATGGATGG + Intergenic
976044750 4:80931676-80931698 ACCAGCTAGCTAAACCAGGATGG - Intronic
976663214 4:87562117-87562139 ATCTGTAAGCTAATAAAGAATGG + Intergenic
983446070 4:167854482-167854504 ACCTGGAACATAAAAAAGGATGG - Intergenic
989721550 5:44534816-44534838 GCCTGTAATCTCAACAAGGTGGG - Intergenic
993712782 5:91244263-91244285 ATCTGAAAGCTAAAGAAGTAGGG - Intergenic
996467541 5:123821077-123821099 GCCTGTCAGCTAAACATGGCTGG + Intergenic
998851204 5:146352421-146352443 ACCTGTAATCTCAACACGTAGGG - Intergenic
1000320574 5:160131310-160131332 ACCTGTAATCTCAGCTAGGAGGG - Intergenic
1005411482 6:25552605-25552627 AACTGGAAGCTTAACCAGGAAGG + Intronic
1006691586 6:35892351-35892373 ACCTTTAAGCAAAAAAAGCAGGG + Intronic
1007394188 6:41568144-41568166 ACTTGTAGGATAAACAAGTATGG + Intronic
1010947653 6:81997027-81997049 CCCTGTAAGAAACACAAGGAAGG - Intergenic
1012146686 6:95693067-95693089 ACATAAAAGTTAAACAAGGAGGG + Intergenic
1012492358 6:99796188-99796210 ACCTGGAAGTGAAACAAGAAGGG - Intergenic
1012791151 6:103697691-103697713 AACTTTAAGATAAACAATGAAGG - Intergenic
1012977670 6:105797370-105797392 ACCTGTGAGCTAGACATGGAAGG - Intergenic
1017234021 6:152100473-152100495 ACCTATAGGCTAAAAAAGAAAGG + Exonic
1018270061 6:162067740-162067762 ACCTATAAACAAAACAAGGTGGG + Intronic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1018791397 6:167150867-167150889 ACCTGTGAGGTAAGCAAGGAAGG - Intronic
1021955540 7:25820860-25820882 ACCTGTAAATGAAACAAGGTTGG + Intergenic
1022037684 7:26549782-26549804 ACCTGTAGGCTGAGCCAGGAAGG + Intergenic
1024410364 7:49033914-49033936 ATTGGTAAGATAAACAAGGAAGG - Intergenic
1031964327 7:128016748-128016770 ACATGTAATCTACACAAGGAGGG - Intronic
1032079482 7:128851499-128851521 ACCTGTAAGGACAACAAGGATGG + Exonic
1034837240 7:154363739-154363761 ACATGTTAGCTAAAGAAAGATGG - Intronic
1035698310 8:1618157-1618179 ACCTGGAACCTAAACATGGAAGG - Intronic
1035960878 8:4136288-4136310 ATCTGGAAGCTAAAAAAAGATGG - Intronic
1036934234 8:12985603-12985625 AGCTGTAAGACAAACAAAGATGG - Intronic
1039108957 8:34020890-34020912 ACAAGAAAGCTAAACATGGAAGG - Intergenic
1042875098 8:73434460-73434482 CCCTGTCACCTGAACAAGGAAGG + Intronic
1043909216 8:85841216-85841238 ACCTGTCAGAGAATCAAGGATGG - Intergenic
1046397279 8:113656759-113656781 ATCTGGAAGATAAAGAAGGAGGG + Intergenic
1047452133 8:124974006-124974028 ACCTGAATGCAAAAAAAGGAAGG - Intronic
1047569225 8:126079551-126079573 ACGTGCAAGCAGAACAAGGAAGG - Intergenic
1047825507 8:128569712-128569734 ATTTGTAAGCTCCACAAGGATGG - Intergenic
1048699846 8:137076498-137076520 ACCGGTAATCTCAACAGGGAGGG - Intergenic
1051135825 9:13919302-13919324 AGCTGTAGGCAGAACAAGGATGG + Intergenic
1051943940 9:22542942-22542964 ACCTCTTAGCTAAACAATGATGG - Intergenic
1055818761 9:80237885-80237907 ACCTGTAAGCCACACAGGGCAGG + Intergenic
1056107676 9:83363030-83363052 ATCTTTATGCAAAACAAGGAAGG - Intronic
1058900395 9:109437554-109437576 AGCTTTAAGTAAAACAAGGAAGG + Intronic
1061639548 9:131941505-131941527 AACTTTAAGCTGAAGAAGGAAGG + Intronic
1187402246 X:18971548-18971570 ACCCAGAAGCTAAACAATGATGG + Intronic
1188333680 X:28901813-28901835 ACCTTTGAGCTATACAAGAAAGG - Intronic
1193544859 X:82813967-82813989 ACCTGTAATCTAAACAACTGAGG - Intergenic