ID: 1121386695

View in Genome Browser
Species Human (GRCh38)
Location 14:93533758-93533780
Sequence AGGATCTTTGTGGTTATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121386688_1121386695 11 Left 1121386688 14:93533724-93533746 CCAAGGCCGGCCCAGATTCAAAG 0: 1
1: 1
2: 9
3: 27
4: 201
Right 1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 206
1121386691_1121386695 1 Left 1121386691 14:93533734-93533756 CCCAGATTCAAAGAGTGGAGAAA 0: 1
1: 7
2: 37
3: 161
4: 652
Right 1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 206
1121386690_1121386695 5 Left 1121386690 14:93533730-93533752 CCGGCCCAGATTCAAAGAGTGGA 0: 1
1: 6
2: 34
3: 109
4: 436
Right 1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 206
1121386692_1121386695 0 Left 1121386692 14:93533735-93533757 CCAGATTCAAAGAGTGGAGAAAT 0: 1
1: 3
2: 32
3: 124
4: 482
Right 1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121386695 Original CRISPR AGGATCTTTGTGGTTATTGA AGG Intronic
901032699 1:6317160-6317182 AGGTGCTGTGTGGTTAATGAAGG - Intronic
902173446 1:14631400-14631422 AGGATTTTGGTTGTGATTGATGG - Intronic
902598029 1:17522257-17522279 GGGAGCTTGGTGGTTAATGAGGG + Intergenic
902647085 1:17807115-17807137 AGGACCTTTGTGATTACTGTGGG + Intronic
904401553 1:30259990-30260012 AGAATCTTTCTGGTGCTTGAGGG - Intergenic
904424641 1:30415550-30415572 AGGGTCTTAGGTGTTATTGAGGG - Intergenic
904779199 1:32932301-32932323 AGTAGCTTTGTGGGTGTTGAAGG - Intergenic
907111200 1:51928066-51928088 AGGAACTTTGAGGATATGGAAGG + Intronic
908548359 1:65184832-65184854 AGGATCTTTCTGGGTTTTCATGG + Intronic
908685450 1:66713472-66713494 TTGATTTTTGTTGTTATTGAAGG + Intronic
911984448 1:104602646-104602668 AGGATCTATGGGGTCAGTGAAGG - Intergenic
912423130 1:109560894-109560916 AGGATCTTGTAAGTTATTGAAGG + Intronic
913338791 1:117735475-117735497 AGGAAATTTGTGGGTATTGGGGG - Intergenic
918072670 1:181144552-181144574 AGGAGCTTTTTGTTCATTGAGGG - Intergenic
918113659 1:181479598-181479620 AGGATCCTCCTGGATATTGAGGG + Intronic
919283558 1:195522964-195522986 AGGATTGTTGTGGTTATTTGGGG - Intergenic
919499314 1:198315926-198315948 AGCATGTTGGTGGTTATTGAAGG + Intronic
920514389 1:206573978-206574000 AGCATCTTTCTTGTTATTTAGGG + Intronic
923433331 1:233945443-233945465 AGGATGTGTCTGGTTATTGAAGG + Intronic
923601713 1:235409445-235409467 TGGAGATTTGTTGTTATTGATGG + Intronic
1067234362 10:44435813-44435835 AGGATTTTCATGGTTCTTGAGGG + Intergenic
1068361697 10:55981933-55981955 AGATTTTTTCTGGTTATTGAGGG - Intergenic
1069011278 10:63375969-63375991 AGGATAGTTTTGGTTATTCAGGG - Intronic
1069292800 10:66803718-66803740 ACTAGCTTTGTGATTATTGATGG - Intronic
1069313280 10:67066040-67066062 ATGATCTATGAGGTTATTTAGGG + Intronic
1069535051 10:69247119-69247141 AGGATTTTTGTGGGCGTTGAAGG + Intronic
1070629436 10:78074455-78074477 AGGACCTTTGTGGTTATATTGGG - Intergenic
1070817693 10:79335691-79335713 GGGATCTTTGTTGTTTTTGTTGG - Intergenic
1071526000 10:86358809-86358831 AGGACCTTTGTGGTTATATTGGG - Intronic
1073718899 10:106142512-106142534 AGGATGTTTGTGGCTCCTGATGG + Intergenic
1076488506 10:130840178-130840200 AGGATCTTTGTGATTCCTTAGGG + Intergenic
1078038747 11:7837258-7837280 AGGATCTTTCCGGTTTTTGTAGG + Intergenic
1078644306 11:13125653-13125675 AGGAGCATTGTGGTAAATGAAGG - Intergenic
1083789831 11:64977259-64977281 AGGATCTCTGTGGTTGGGGAGGG - Intergenic
1084531917 11:69732458-69732480 AGGGTCTTTATGGTAATTGATGG - Intergenic
1085196427 11:74674818-74674840 AGGATCTTTGTGATTATATTGGG + Intergenic
1086199847 11:84188865-84188887 AGGCTCTGGGTGATTATTGAGGG - Intronic
1086333213 11:85774722-85774744 AGGATTTTTGTTGTTCATGAGGG - Intronic
1086590662 11:88510276-88510298 AGGATCCTGGTGAATATTGAGGG + Intronic
1088393313 11:109340049-109340071 AGGGTCTTTGTTGTTATTCCAGG + Intergenic
1089861758 11:121596368-121596390 AGGATCTTTGCAGTGAGTGATGG + Intronic
1092476953 12:8827835-8827857 AGTATCTCTGTGGCTCTTGAAGG + Intronic
1093385232 12:18544994-18545016 AAGATCATTGTGGTTATGTATGG - Intronic
1093616196 12:21228573-21228595 AGGATATTTGTGGTTATATTGGG - Intronic
1094664390 12:32504230-32504252 AGAAACTTAGTGGTTCTTGAGGG + Intronic
1095747326 12:45674331-45674353 AGGATTTCTGTGGTCATTGGAGG - Intergenic
1103778312 12:123382896-123382918 AGGATCTTTGCGGTCCTGGAAGG + Intergenic
1104153983 12:126112768-126112790 AGGATCTTTAGGATTATTGCAGG - Intergenic
1104341158 12:127950233-127950255 AGGATGTAGGTGGATATTGACGG + Intergenic
1105287720 13:19019843-19019865 AAGATCGTTGTGGTTATTTGGGG - Intergenic
1106741674 13:32650207-32650229 ACAAACTTTGTGGTTATTGTTGG + Intronic
1106979656 13:35263001-35263023 AGGATTATTTTGGTTATTCAGGG - Intronic
1107013003 13:35686159-35686181 TGCATCTTTATGGTTATAGAGGG + Intergenic
1108434129 13:50385099-50385121 AGGAATTTTATGCTTATTGAAGG + Intronic
1109815007 13:67569913-67569935 AGGATCTATGTTGTTATTGTGGG + Intergenic
1111905148 13:94246831-94246853 AGAATCGTTGTGGCTATTTAGGG + Intronic
1113184058 13:107666280-107666302 ATGATCTTTGTTCTTATTGGTGG + Intronic
1114700520 14:24673637-24673659 AGCATCTTTTTGGGTCTTGATGG + Intergenic
1116662948 14:47735560-47735582 AGGATGTTTGTGGTTATACAGGG - Intergenic
1117012003 14:51480560-51480582 TGCATCTCTGTGGTTCTTGAGGG + Intergenic
1120484808 14:85099623-85099645 TGGATTTTTATGTTTATTGATGG + Intergenic
1121001413 14:90454308-90454330 AGGAGCTTTGTGTTTAGTAAAGG + Intergenic
1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG + Intronic
1125790579 15:42362481-42362503 AGGATCTTTGTTGTTGGTGATGG - Intronic
1128179994 15:65593812-65593834 AGGATATTAGTGGTTATTTGGGG + Intronic
1129141042 15:73598196-73598218 TGGATCTATGGGGTTATGGAGGG - Intronic
1130919769 15:88334309-88334331 AGGATCTTTGTGCTAATTGCTGG - Intergenic
1132280305 15:100607998-100608020 AGAATCCTTGTGGTTGTTGCTGG - Intronic
1134284830 16:12851788-12851810 AGGATCATTGAGGTTCTTGAAGG - Intergenic
1134465205 16:14469630-14469652 AGCATGTTTGTGTTTATTTAGGG - Intronic
1135026279 16:19001748-19001770 AGGAGCTATGTGGTGTTTGAAGG + Intronic
1135876741 16:26208026-26208048 AAGATTTTTGTGGCTATTCAGGG - Intergenic
1136999093 16:35213447-35213469 ATGTTCTTTGTGGCTGTTGAAGG - Intergenic
1139030295 16:62872787-62872809 AATATCTTTGTGATTATAGAAGG - Intergenic
1140119766 16:72073482-72073504 AGTATCTTTGGGGTGACTGAGGG + Intronic
1141612147 16:85187831-85187853 ATGATCGCTGTGGTTATTTAGGG + Intergenic
1203052180 16_KI270728v1_random:886203-886225 AGGTTCTATGTGGATTTTGAAGG + Intergenic
1142626136 17:1193276-1193298 TGAATCCTTGTGGGTATTGAGGG - Intronic
1143629165 17:8127476-8127498 AGGATCTTGGAGAGTATTGAAGG + Intergenic
1143867373 17:9933926-9933948 ATGCTCTTGGTGGATATTGATGG + Intronic
1145068740 17:19784461-19784483 AGGATCTATGTGCTTACTCAGGG - Intronic
1147521115 17:41174493-41174515 ATGATCTATGTGGTTTTTGTTGG - Intergenic
1148815025 17:50321429-50321451 AGGATCTCTCTGGTTTTTGTAGG - Intergenic
1151499360 17:74479056-74479078 AGGATGTATGTGATTATTGTAGG + Intronic
1152785810 17:82247393-82247415 GGGATCTTTGTGGGCAGTGAAGG - Intronic
1153181440 18:2439402-2439424 ATCATGTTGGTGGTTATTGAAGG + Intergenic
1156023586 18:32627008-32627030 AGAATATTTGTGCTTATTGAGGG + Intergenic
1158178741 18:54687692-54687714 AGTTTTTTTGTGGTCATTGAGGG + Intergenic
1158694343 18:59690104-59690126 AGGATTTTTGTTGTTGTTGGGGG + Intronic
1159643556 18:70891070-70891092 AGCATCTTTGTAGTCTTTGATGG + Intergenic
1159978147 18:74741046-74741068 AGGAAGTTTGAGATTATTGATGG + Intronic
1161018529 19:1996264-1996286 AAGATCGTTGTGGCTATTCAGGG + Intronic
1162187330 19:8915958-8915980 ATGATATTTGTGGTTCATGATGG - Intronic
930730858 2:54725847-54725869 AGCATCATTGAGGTTATTAAAGG + Intronic
930992533 2:57675608-57675630 TGGATTTTTGTTGTTGTTGATGG + Intergenic
931611807 2:64109149-64109171 AGGATCCTTCTTGTTATTGCTGG - Intronic
932732869 2:74232928-74232950 AGGGTCTTTGCGGTTCCTGAGGG + Intronic
934188058 2:89763654-89763676 GGGATCTTTGGGGTTCTTGTGGG + Intergenic
934508352 2:94915654-94915676 AGGATCTTTGTGATTATACTGGG - Intergenic
935282063 2:101526870-101526892 AGGATGTTTGTGGCAAGTGATGG + Intergenic
936480074 2:112877770-112877792 AGGATCATTGTGGGAATTAAAGG - Intergenic
936743232 2:115540996-115541018 AGCATTTTTGTATTTATTGAAGG + Intronic
936892222 2:117384979-117385001 AGGATTGTTTTGGCTATTGAAGG + Intergenic
937006870 2:118524661-118524683 TGCATCTTTGAAGTTATTGATGG - Intergenic
937614717 2:123908058-123908080 AGGATCTTTCTGGTTAGTTAGGG + Intergenic
938308912 2:130272919-130272941 AGAATATTTGTATTTATTGATGG - Intergenic
938885188 2:135639325-135639347 AGAATTTTTATGGTAATTGATGG - Intronic
939999816 2:148955946-148955968 AATATCTTTGTGGTTATTCCAGG + Intronic
940033250 2:149287080-149287102 AGGCTCTTTGAGGTTATAGTAGG - Intergenic
940837494 2:158539698-158539720 TGGATCTCAGTGGTTTTTGAGGG + Intronic
941854422 2:170216132-170216154 AGGATCTGTGGGTTTATTGGGGG - Intronic
943363855 2:186950839-186950861 TGTTTCTTTGTGGTTTTTGACGG + Intergenic
943986503 2:194627335-194627357 AGGTTCTTTGTGTATATTGGAGG + Intergenic
946108706 2:217395080-217395102 AGCATCCTTATGGTTATTGAAGG + Intronic
948403268 2:237699914-237699936 AGGCTCTTTGTGGTTCCTGGGGG + Intronic
948490223 2:238308053-238308075 AGGATCCATGTGGTTTTTGCAGG + Intergenic
948774793 2:240278562-240278584 AGTCTCTTTCTGGTAATTGAGGG + Intergenic
1168786115 20:542032-542054 AGTATCTTTGTAGTTGTTGTAGG - Intronic
1169338073 20:4773769-4773791 AGGATCCTTGAGGTTTTTTAGGG + Intergenic
1169939762 20:10924351-10924373 AGAATCTTAGTGATTAGTGATGG + Intergenic
1170054666 20:12188128-12188150 ATTTTCTTTGTGGTTATTGCAGG + Intergenic
1171463361 20:25311261-25311283 AGGACCCTTGTGGTTATTTTGGG - Intronic
1172731402 20:37091833-37091855 AGGAACATTGGGTTTATTGATGG - Intronic
1172956638 20:38764523-38764545 AGGTTCATTGTGGTCATAGAGGG + Intronic
1173711526 20:45161031-45161053 AGGATTCTTTTGGTTATTGGGGG - Intergenic
1174183493 20:48689597-48689619 AGTATCTTTGTGGTCTTTGTTGG - Intronic
1175123073 20:56731322-56731344 CGGACCTTTGTGGATACTGATGG + Intergenic
1175824878 20:61931389-61931411 AGGAGCTCTGTGGGTATTGGCGG - Intronic
1179590839 21:42406887-42406909 AGGATGTTTGTGTTTATTGATGG + Intronic
1182028729 22:27140387-27140409 GGGATCTTTGGGGTGATTCATGG + Intergenic
1182067582 22:27441674-27441696 GGAATCTTTGTGGGTTTTGAGGG - Intergenic
1183585137 22:38749103-38749125 AGGTTCCTTGTTGTTATTTAAGG - Intronic
950134135 3:10568702-10568724 AGCATCTGAGTGGTTATTCAGGG - Intronic
950277571 3:11676028-11676050 TGGCTCTCTGTGGTTTTTGAAGG - Intronic
951644883 3:24878798-24878820 AGAATCTTTGTGGTTTTTCTTGG + Intergenic
957265072 3:77952973-77952995 AGGATCTTTGTGATTATATTGGG + Intergenic
960255883 3:115511249-115511271 AGGATCTTTGTGATTACACAGGG - Intergenic
960887130 3:122407360-122407382 TGCATCTTCATGGTTATTGAGGG + Exonic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
964750694 3:160051284-160051306 TGTTTCTTTGTGGTTTTTGAGGG + Intergenic
964767100 3:160189842-160189864 GGGATGATTGTGCTTATTGATGG - Intergenic
966586796 3:181635214-181635236 AGGATCCTTGTGATAATTAAAGG - Intergenic
967250083 3:187528490-187528512 AGGATTTATGTGGTTAGTAAGGG - Intergenic
968485180 4:857234-857256 AGGATCTGTGTGTATATTCATGG + Intronic
968775749 4:2538633-2538655 TGGATCTTTGGGGTTTTTAAGGG + Intronic
970638638 4:18038358-18038380 AGGATGTATGTGGTGAGTGAGGG + Intergenic
973239844 4:47945807-47945829 AGGATCTATTTGGTTTTTGTGGG - Intronic
973756744 4:54082259-54082281 AGGATGTTTGTGTTTCCTGAAGG - Intronic
974731350 4:65870731-65870753 AGGTGCTTTGAGGTTTTTGAAGG - Intergenic
975633667 4:76424552-76424574 GGGATCTGTGTGGTTATTGTGGG + Intergenic
975645552 4:76542482-76542504 AGGATCTTTGTGATTATATTTGG - Intronic
976626030 4:87183149-87183171 AGGATCTTTGTTGTATTTGAGGG - Intronic
976733307 4:88285105-88285127 AGTATTTCTGTGTTTATTGAAGG + Intergenic
977738804 4:100451878-100451900 AGGATCTTTGTGAAGATTAAGGG - Intronic
981974705 4:150711700-150711722 AGTACCTTTATAGTTATTGATGG - Intronic
982500350 4:156146926-156146948 GACATCTTTGTGGTTATTAAAGG - Intergenic
983995590 4:174177440-174177462 ATGATTTTTGTGTTTTTTGAAGG - Intergenic
984258472 4:177415233-177415255 AGGGTCGTGGTGGTTACTGAAGG + Intergenic
985037078 4:185851284-185851306 ATGGTCTTTGTGGTAGTTGAAGG - Intronic
985059323 4:186060182-186060204 AGTTTCTTTGTGGTTATCGTGGG + Intergenic
986927523 5:12774738-12774760 AGTATCTATGTGATTATTGCTGG - Intergenic
987306429 5:16642023-16642045 AGGATCTGTCTGGTTTTTGCAGG + Intergenic
989826891 5:45867394-45867416 AGTATCTTTGTAGCTATTAATGG - Intergenic
990166092 5:52994951-52994973 AGGATCTCTGAGGTTCTTCATGG - Intronic
990733079 5:58830810-58830832 TGGAGCTTGGTGGTTATGGAAGG - Intronic
992942207 5:81773487-81773509 TGGATCTTTTTGGTTATGAAGGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1000547847 5:162623925-162623947 AATATCTTCCTGGTTATTGAGGG - Intergenic
1001266811 5:170279754-170279776 AGGAACTTTGTGATTATGAAGGG + Intronic
1002858666 6:1059989-1060011 AGGATCTCTGTGGTTCCAGAAGG + Intergenic
1004109896 6:12707260-12707282 AAGTTCTTTGTGATTCTTGAAGG - Intergenic
1007604072 6:43103798-43103820 AGGAACAGTGTGGTTAGTGAAGG - Intronic
1007730230 6:43941132-43941154 AGAAGCTTTGTGGTTTTGGAAGG - Intergenic
1008975313 6:57419220-57419242 AGGATCTTGGTGGCCATTGATGG + Intronic
1009164192 6:60320733-60320755 AGGATCTTGGTGGCCATTGATGG + Intergenic
1009760221 6:67995730-67995752 AGGATCTGTGTGATTTTTGTAGG - Intergenic
1010089913 6:71968534-71968556 AAGACCTGTGTGGTGATTGATGG + Intronic
1010438738 6:75867032-75867054 AGTATCTTTGTTGTTATTTGTGG - Exonic
1010913942 6:81592392-81592414 AGGATTACTTTGGTTATTGAGGG + Intronic
1012724017 6:102784936-102784958 ATGATCTTTGTAGTTATAGATGG - Intergenic
1012863117 6:104585430-104585452 AGGATCCATGTGGTTAGTGTTGG + Intergenic
1012974521 6:105765800-105765822 AGGATATATGTGGTTTTTGGTGG + Intergenic
1013423366 6:109987074-109987096 AGGAACATGGTGGTCATTGATGG + Intergenic
1013633312 6:112006070-112006092 AGGATCTGTCTTGTTTTTGAAGG + Intergenic
1014576841 6:123083563-123083585 AGGATTTTTGTGACTATTAAAGG + Intergenic
1016087335 6:139929871-139929893 AAGAGCTTTGTGGTTATTGTTGG - Intergenic
1018657379 6:166051452-166051474 GAGATCTTTGTGGTGATTCATGG - Intergenic
1022173076 7:27848024-27848046 AGGATCACTTTGGTTATTTAGGG + Intronic
1023048056 7:36228700-36228722 AGGATATTCGTGTTTATTGATGG + Intronic
1025228972 7:57186852-57186874 AGGATGTTCGTGTTTACTGATGG - Intergenic
1025731339 7:64111103-64111125 AGGATGTTCGTGTTTACTGATGG + Intronic
1025733983 7:64130988-64131010 AGGATATTTTTGGTTTGTGATGG + Intronic
1030451340 7:109716588-109716610 ATGATTTTTTTGGTTATTAAAGG - Intergenic
1031154230 7:118090006-118090028 AGGATCTTTGTGTTGAGTCAAGG + Intergenic
1031180769 7:118412162-118412184 AGGCTCTTTTTGGTCATTGAAGG - Intergenic
1032454793 7:132065207-132065229 AGGATTTTGGTAGTTGTTGAAGG + Intergenic
1033487251 7:141803034-141803056 AGGATGTTCGTGTTTATTGATGG + Intergenic
1033675319 7:143535470-143535492 AGTCTCTTTTTGATTATTGAGGG + Intergenic
1033696518 7:143793968-143793990 AGTCTCTTTTTGATTATTGAGGG - Intergenic
1035486241 7:159228338-159228360 AGGATCTTTGCAGTGATTGGAGG + Intergenic
1035557570 8:578292-578314 AGCTTCGTTGTGGCTATTGAAGG + Intergenic
1038359347 8:26861961-26861983 AGGATCATTCTGGTTGTTGGGGG - Intronic
1038634329 8:29273238-29273260 AGGATCTTCTTGGATGTTGAAGG + Intergenic
1039004224 8:33015699-33015721 AGGATGTTCGTGTTTGTTGATGG - Intergenic
1040371154 8:46776708-46776730 AGGATTTTTGTGGTTCATCAGGG + Intergenic
1041747058 8:61219064-61219086 AGGATCTCTGAGGTCACTGAAGG + Intronic
1044804592 8:95992190-95992212 AGGATCTTTATGGTAGCTGAAGG + Intergenic
1045132298 8:99166743-99166765 AAGATCTTTTTGGTTATTTGGGG - Intronic
1048928449 8:139291537-139291559 AGAAGCATTGTGGTTCTTGAGGG - Intergenic
1052635917 9:31104015-31104037 AGGATATCTGTGGTTTTGGATGG + Intergenic
1060382835 9:123192837-123192859 AGGTAATTAGTGGTTATTGAAGG - Intronic
1062108490 9:134768535-134768557 AGGCTCTTTGGGGTTGTTGTTGG + Intronic
1185505120 X:627660-627682 AGGAGCTGTGTGGCTATTCAAGG - Intronic
1186027167 X:5325906-5325928 CTGATCTTTTTGGTTATTTAAGG + Intergenic
1186564928 X:10652318-10652340 AGAATCTTTGTAGTTATCCATGG + Intronic
1187627024 X:21126504-21126526 AGGATTTTTGCTGTTACTGATGG + Intergenic
1191871673 X:65751531-65751553 AGTATCTTTCTGGCAATTGATGG + Intergenic
1193794886 X:85862250-85862272 AGAATTTTTGTGGTTATTCTAGG + Exonic
1193846047 X:86472209-86472231 AGGATCTTTGTGATTACAAAGGG - Intronic
1194248904 X:91548742-91548764 TGGAGCCTTGTAGTTATTGAAGG - Intergenic
1194472579 X:94315612-94315634 AGGATTGTTTTGGTTATTTAGGG + Intergenic
1195418606 X:104647621-104647643 AGGATCTTGGTAGTGATGGATGG + Intronic
1195672051 X:107477966-107477988 AGGATCTAGGTGGGTCTTGAAGG - Intergenic
1197028069 X:121779800-121779822 AAAATCTTTGTGGGTATTTAAGG + Intergenic
1198166831 X:134066022-134066044 AGGATCTTTTAGGTTATTAGAGG - Intergenic
1198186455 X:134258265-134258287 AGGATCTATCTGGTTTTTGCAGG + Intergenic
1198518287 X:137429126-137429148 AGGATCTTCGGGATTGTTGAGGG + Intergenic
1199374774 X:147095125-147095147 AGGATCTTTGTGGTTGTAAATGG + Intergenic
1200567914 Y:4790279-4790301 TGGAGCCTTGTAGTTATTGAAGG - Intergenic