ID: 1121388407

View in Genome Browser
Species Human (GRCh38)
Location 14:93551966-93551988
Sequence GAATCCTTCTGGGATGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121388402_1121388407 -10 Left 1121388402 14:93551953-93551975 CCTGTAGGGACTAGAATCCTTCT 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1121388407 14:93551966-93551988 GAATCCTTCTGGGATGGTATGGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121388407 Original CRISPR GAATCCTTCTGGGATGGTAT GGG Intronic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
908982472 1:69975769-69975791 GAAGACTGCAGGGATGGTATGGG - Intronic
911615757 1:100009008-100009030 GAAATCTTCAGGGATGATATTGG + Intronic
916783764 1:168067014-168067036 GATTTCTTCTGGGATGGGAGAGG + Intronic
919698476 1:200606233-200606255 TAATACATCTGGGATTGTATTGG - Intronic
919701728 1:200638249-200638271 CAATCCTTCAGTGATGGTATTGG + Intronic
923520744 1:234733243-234733265 GTGTCCTTCAGGGATGGCATGGG - Intergenic
923687104 1:236161030-236161052 GGTTCCTTCTGGGATGGAAAAGG - Intronic
1065495973 10:26328351-26328373 GACTTCTTTTGGGATGGTCTTGG - Intergenic
1066266390 10:33779812-33779834 TATTCTTTCTGGGATTGTATTGG - Intergenic
1069269941 10:66513934-66513956 GCAACCTTCTGGGATGGTGTCGG + Intronic
1069802140 10:71088391-71088413 TTTTCCTTCTGGGATGTTATGGG - Intergenic
1069815409 10:71190792-71190814 GACTCTATCTGGGATGGGATAGG + Intergenic
1069853545 10:71425922-71425944 GATTCCTTTTGGGAAGGTTTTGG + Intronic
1071562333 10:86654075-86654097 GAAGATTTCTGGGATGGTGTTGG - Intergenic
1072817165 10:98520755-98520777 GAATCAAGCTGGGATGGTACTGG + Intronic
1074647097 10:115468890-115468912 TAATACTTCTGGGATATTATTGG + Intronic
1074692776 10:116021537-116021559 GAATCCTGCTGATATGGTTTGGG - Intergenic
1076147082 10:128131196-128131218 GAATCCTTCAGGCATGATAGAGG - Intergenic
1080144193 11:28960093-28960115 GAATCCATTTGGAATGGTGTAGG + Intergenic
1081045437 11:38268290-38268312 GAATCCTGTTGAGATGGTATTGG - Intergenic
1089127969 11:116190786-116190808 GAATCCTTCTGGGTTGCCTTGGG - Intergenic
1091304482 11:134528732-134528754 GATTTCTTCTGGAATGGTATAGG + Intergenic
1091430072 12:426423-426445 GAATCCATCTGGTTTTGTATGGG + Intronic
1093026511 12:14250149-14250171 GAAACCTTTTGGGAAGGTTTGGG - Intergenic
1095136619 12:38612871-38612893 GAATCCTTCTGAGATGGAAGAGG - Intergenic
1096669335 12:53189230-53189252 GAATCCTTATGGGAAGTTTTGGG + Exonic
1097249933 12:57626940-57626962 GAATTCTTCTTGGATGGGCTTGG - Exonic
1099135758 12:78898325-78898347 GAATAGTTTTGGCATGGTATAGG - Intronic
1101648183 12:106650909-106650931 GAGTGCTTCCGGGATGCTATAGG - Intronic
1103434629 12:120915243-120915265 GACTTGTTCTGGGATGGTGTGGG + Intergenic
1104918593 12:132278985-132279007 GAGTCCTGTTGGGATGGGATGGG - Intronic
1112574859 13:100626868-100626890 GACTCCTAATGTGATGGTATTGG + Intronic
1113899992 13:113791382-113791404 GGATCCTCCTGGGATGGCTTCGG + Intronic
1114374718 14:22131975-22131997 GAAACCTGCTGGGCTGGTTTTGG + Intergenic
1116476579 14:45347336-45347358 AAATGCTTATGGGAAGGTATGGG - Intergenic
1117477805 14:56115416-56115438 GACTCCCTCTGGGATGATGTGGG + Intergenic
1121388407 14:93551966-93551988 GAATCCTTCTGGGATGGTATGGG + Intronic
1126358718 15:47823470-47823492 CAACCCTGCTGGGATGGTATTGG + Intergenic
1131061000 15:89404712-89404734 GCAGCCTTGTGGGATAGTATGGG - Intergenic
1132628894 16:906841-906863 CAATCCTTCTGGGATTGCTTGGG + Intronic
1133006468 16:2884218-2884240 GAAACCTGCTGGGAGGGTAAGGG + Intronic
1135145530 16:19959577-19959599 GGCTCCTCCTGGGATGGTAGGGG - Intergenic
1135229244 16:20690204-20690226 GAATCCCCCTGAGATGGAATTGG - Intronic
1140999276 16:80292958-80292980 GAATACTTTTGGGATGAGATTGG - Intergenic
1149400652 17:56292597-56292619 GAAGCTTTCTGGTTTGGTATTGG - Intronic
1151995410 17:77605345-77605367 AAATTCTTCAGGGATGGGATGGG + Intergenic
1152438538 17:80290754-80290776 GAATCCCTCAGGGAAGGCATAGG + Intronic
1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG + Intronic
1153949666 18:10047354-10047376 GAATCATTGTAGGATGGTGTAGG - Intergenic
1156588661 18:38461070-38461092 GAATCCTTTAGGGCTGGTACTGG + Intergenic
1157801426 18:50624719-50624741 GAATCCTTTTGTGATGGTGATGG + Intronic
1158699088 18:59730459-59730481 AGATCCTTCTGGAATGATATGGG + Intergenic
1160352068 18:78191932-78191954 GAGGCCTTCTGGAATGGCATGGG - Intergenic
1160476570 18:79195100-79195122 GCATCCTTTTGGGATGGTGTGGG - Intronic
1161652451 19:5493550-5493572 GAATCCCTGTGGGATGACATTGG - Intergenic
1168629114 19:57943443-57943465 GAGTCATTCTGGGCTGGTCTTGG - Intronic
927367739 2:22318619-22318641 GTATACTTCTGGGATGGGATAGG + Intergenic
927855572 2:26525522-26525544 AAAGCCTTCTGGGAGGGTAGGGG + Intronic
928211180 2:29325047-29325069 GACTCCCTCTGGGAAGGTGTGGG + Intronic
928585095 2:32751772-32751794 GAGTCCTTCCTGAATGGTATTGG + Intronic
929855905 2:45638566-45638588 GAATCCATCTGGGAAGCTCTAGG - Intergenic
942176376 2:173338727-173338749 CAATCCTTCTGGAATTGCATGGG + Intergenic
942882718 2:180882650-180882672 AAATCCTTCTTGGCTGGGATTGG + Intergenic
944128848 2:196324189-196324211 AAATCTTTCTGGGCTGGCATAGG - Intronic
1169636299 20:7695789-7695811 GAATCTTTCTGAGGTGGTTTGGG - Intergenic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1179218997 21:39389853-39389875 GAATTCTTCTGGGAGGGGAGAGG + Intronic
1179304970 21:40145400-40145422 GAATCATTCTGGAATGATTTGGG + Intronic
1181833256 22:25580031-25580053 GAATACTTTTGAGATGGTTTTGG - Intronic
1182819370 22:33201845-33201867 GAATCATTCTGGGCTGGGCTTGG + Intronic
949339197 3:3010167-3010189 GAATACTTCTGGGATGGGGAGGG + Intronic
960257396 3:115525337-115525359 GAGGCACTCTGGGATGGTATAGG + Intergenic
964083569 3:152789391-152789413 AGATCCTCCTGGGATAGTATTGG - Intergenic
968077135 3:195822199-195822221 GAATCATTCTGGAATGGTGAGGG + Intergenic
970096988 4:12475339-12475361 GAAACCGTCTGGGATGCAATGGG - Intergenic
970676234 4:18453491-18453513 CAATCCTTTTGGGAAGGTAAAGG - Intergenic
972250075 4:37290506-37290528 TAGTCCTTCTGGGAAGTTATAGG + Intronic
975026707 4:69557888-69557910 GAAACCTGCTGGGAGGTTATTGG - Intergenic
976855532 4:89600484-89600506 AAATACTTCTTGGATGGTGTAGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978895189 4:113878444-113878466 GGATCCTCCTGTGATGGTAAGGG - Intergenic
982338166 4:154263833-154263855 TAATCCTTCTGTGATCATATGGG - Intronic
987861856 5:23499666-23499688 GAAGCCTTCTGGGAGGTGATTGG - Intergenic
995732492 5:115261226-115261248 GAATCTTTCAGTGAAGGTATAGG + Intronic
996452342 5:123639773-123639795 GAGTCCTTCTGTTATGGTCTAGG + Intergenic
1008912457 6:56749976-56749998 GAGCCCTTCTGGGATGGTGTTGG - Intronic
1012838179 6:104296127-104296149 GATACCTTCTGGGATGGTTTCGG + Intergenic
1020480965 7:8659961-8659983 GAGACGTGCTGGGATGGTATTGG + Intronic
1020506334 7:8993393-8993415 GAATCATTTTGGGATGGGAAAGG - Intergenic
1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG + Intronic
1032455261 7:132068301-132068323 GAATCCTTCTGGGAATATCTGGG - Intergenic
1033855190 7:145552527-145552549 GATTGCTTCTGGGAAGATATAGG + Intergenic
1034992975 7:155559768-155559790 GAAGCCCTAGGGGATGGTATTGG - Intergenic
1035927781 8:3747268-3747290 GAATCCCTCCTGGATGGCATGGG - Intronic
1036012254 8:4739741-4739763 GAATCTTTGTGGGAAGGGATAGG - Intronic
1037720934 8:21443275-21443297 GAATCATTCTGGGAAGTTAAAGG - Intergenic
1038978895 8:32734469-32734491 GAACTCTTCTAGGCTGGTATTGG - Intronic
1040288677 8:46113278-46113300 GAAGGCTTCTGGGATGGGAGAGG + Intergenic
1040325271 8:46338459-46338481 GAAGGCTTCTGGGATGGAAGAGG - Intergenic
1040335215 8:46412654-46412676 GAAAGCTTCTGGGATGGGAGAGG - Intergenic
1040902160 8:52428236-52428258 GAATCCTTCTGGCATGACAGGGG - Intronic
1041481788 8:58330164-58330186 AAATTCCTCTGGGAAGGTATTGG + Intergenic
1041506110 8:58599601-58599623 GAATACTTCTGATATGGAATAGG + Intronic
1045458053 8:102401398-102401420 GAAACATTCAGGGATGGTATGGG + Intronic
1048740499 8:137553694-137553716 AAATGCTTCTGAGATGATATAGG + Intergenic
1048844026 8:138589477-138589499 AGATCCTTCTGGGAGGGGATGGG + Intronic
1050849119 9:10262523-10262545 GTATCCTACATGGATGGTATAGG - Intronic
1051292980 9:15564217-15564239 GAATTCTCATGGGATGGTAAGGG + Intronic
1057369893 9:94461834-94461856 GAAAAGTTCTGGGATGGTAATGG + Intergenic
1059358353 9:113718839-113718861 GAAACCTTGTGGGAGGGGATTGG - Intergenic
1059360007 9:113734847-113734869 GATTCCTTCTGTGTTGGTCTGGG + Intergenic
1061111615 9:128576137-128576159 GAATCCATCTGGGATACCATGGG - Intronic
1061494428 9:130963604-130963626 GAATCCTGCTGGGCTGGTTTAGG - Intergenic
1187575500 X:20549877-20549899 GTATCCTTATGGCATGGAATGGG - Intergenic
1189286133 X:39853713-39853735 GAATTCTTCTGGGATGGAAAAGG + Intergenic
1190408164 X:50108416-50108438 GACTCCTTCTGTGATGGCTTAGG + Intergenic
1190679538 X:52812987-52813009 GAATCGTTTTGGGATAGTGTAGG + Intronic
1195740802 X:108062862-108062884 GATTCCTTCTGGGAAGGTGGAGG - Intronic