ID: 1121390604

View in Genome Browser
Species Human (GRCh38)
Location 14:93570283-93570305
Sequence CAATTTCAAAATAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121390604_1121390608 -9 Left 1121390604 14:93570283-93570305 CCAACTGCCCTATTTTGAAATTG 0: 1
1: 0
2: 0
3: 22
4: 210
Right 1121390608 14:93570297-93570319 TTGAAATTGTCCCCTTAGGTCGG 0: 1
1: 0
2: 1
3: 11
4: 104
1121390604_1121390612 15 Left 1121390604 14:93570283-93570305 CCAACTGCCCTATTTTGAAATTG 0: 1
1: 0
2: 0
3: 22
4: 210
Right 1121390612 14:93570321-93570343 GAGAAAATTTCTAACTGACATGG 0: 1
1: 1
2: 2
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121390604 Original CRISPR CAATTTCAAAATAGGGCAGT TGG (reversed) Intronic
900343451 1:2199436-2199458 CAATTTCCCAGCAGGGCAGTGGG - Intronic
901356516 1:8654335-8654357 AAATTTCAAAAGATGTCAGTGGG - Intronic
902197627 1:14809563-14809585 TACTTTCAGAATAGGGCACTTGG - Intronic
904689545 1:32283510-32283532 CAATTTAGAAATAGGGAAGGAGG + Intronic
907895579 1:58687012-58687034 CAGTTTCAAAATAGAGCAAAGGG + Intronic
908770343 1:67590350-67590372 CAATTTGAAAAAAAGGCACTTGG + Intergenic
908991195 1:70092117-70092139 CACTTTCAGAATAGGGCACTAGG - Intronic
909206037 1:72759045-72759067 CCATTTCAAAAGAGGGAAGGAGG + Intergenic
909588868 1:77322885-77322907 CTCTTACAAAATAGGGCATTTGG - Intronic
909633152 1:77787689-77787711 CAATTTCAAAAATGGGCAAAGGG - Intronic
910063097 1:83117544-83117566 TAAGTTAAAAATAAGGCAGTTGG - Intergenic
910730502 1:90390746-90390768 CCATTTTGAACTAGGGCAGTGGG + Intergenic
913502102 1:119480753-119480775 ACATTTCAAAAGAGGGCAGAAGG + Intergenic
919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG + Intergenic
919313038 1:195936095-195936117 CAATTTCAAGATAGGTTTGTGGG + Intergenic
919425684 1:197427428-197427450 CAATGTCAAAATAGAGGAGGAGG - Intronic
919579571 1:199354969-199354991 CATGTTCAAAATATGGAAGTTGG - Intergenic
920240352 1:204543188-204543210 CAATTTCAAAATGGAGCCTTTGG + Intronic
920696035 1:208181865-208181887 AAATTTCAAAATAAGAAAGTTGG - Intronic
921999051 1:221455596-221455618 TAATTTCAAAACATGGCAATAGG - Intergenic
923298636 1:232619748-232619770 CAATTTTAAAATAAGGATGTGGG - Intergenic
1064021667 10:11814085-11814107 CAATTTCTAAATTGGTAAGTAGG - Intergenic
1064617270 10:17172832-17172854 AAATATCAAAATAGACCAGTAGG + Intronic
1065288299 10:24206246-24206268 AAATTTCAAAGTATAGCAGTAGG + Intronic
1065988996 10:30989085-30989107 AAATTGCAAAATAGGCTAGTAGG - Intronic
1066672558 10:37856142-37856164 CAAATCCAAAATAGTGCAGTTGG - Intronic
1073572583 10:104592984-104593006 CATCTTCAAAATAGTGTAGTGGG + Intergenic
1073842457 10:107513596-107513618 GAATTTTAAAATAGGGTGGTAGG + Intergenic
1074025505 10:109629597-109629619 TTATTTCAAAATAGAGCAGGAGG - Intergenic
1076347494 10:129789519-129789541 CACGTTCTAAAAAGGGCAGTGGG + Intergenic
1077884076 11:6372954-6372976 CAATTTCAAAAGAGAGGAGTGGG + Intergenic
1079309653 11:19353544-19353566 CATTTTCAACATAGGACAATGGG + Intronic
1079453091 11:20614325-20614347 CATTTTCAAAATAAGGAAGCAGG - Intronic
1082899626 11:58232855-58232877 CAATTTCCTAATATGGCATTAGG + Intergenic
1086116675 11:83258719-83258741 ATATTTAAAAAAAGGGCAGTGGG - Intronic
1086308512 11:85508745-85508767 CAATTTCAAAGTAGAACATTTGG - Intronic
1088195978 11:107274226-107274248 CAGTTTCAAAATAGAGAACTGGG + Intergenic
1088402743 11:109439275-109439297 CAATTTGAAAATAGTGAAATAGG + Intergenic
1090539787 11:127688547-127688569 AAATTTAAAAATAGGGCAGAAGG - Intergenic
1090788212 11:130068991-130069013 CAATTGCTAAATGGGGCAGCAGG + Intergenic
1093187414 12:16036823-16036845 TAATTAAAAAATTGGGCAGTAGG + Exonic
1093460145 12:19400659-19400681 AAATTTAAAAATTGGCCAGTGGG - Intergenic
1093924540 12:24896336-24896358 TAATTTCAAAACAGGCCAGCTGG - Intronic
1094483461 12:30904445-30904467 CAAAATCAAAATATGGCAATGGG - Intergenic
1097311130 12:58120565-58120587 CAATATCAAAACAGGGAAATTGG + Intergenic
1098236374 12:68422322-68422344 CAATTTAAAAGTAGGTCAGTGGG - Intergenic
1098377172 12:69829285-69829307 TATTATCAAAAGAGGGCAGTGGG + Intronic
1105485899 13:20832111-20832133 CAGTTACAGAATAGGGCAGGTGG - Intronic
1107714665 13:43188287-43188309 AAATTTGGAAATAGTGCAGTAGG - Intergenic
1109371874 13:61432667-61432689 CATTTGTATAATAGGGCAGTTGG + Intergenic
1109960994 13:69630542-69630564 CAACTTTAGAATATGGCAGTAGG + Intergenic
1110546395 13:76760649-76760671 CAATTTTAGACTAGGCCAGTAGG - Intergenic
1110632032 13:77720176-77720198 AAATTTAAAAAAAGGGCAGTTGG + Intronic
1112881379 13:104109924-104109946 CCATTCCAAAATAGGGAAATTGG - Intergenic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1117170332 14:53087771-53087793 CAAATTCAAAATATAGCAGAAGG + Intronic
1120040449 14:79747021-79747043 CAAGTACACAATAGGGCATTTGG + Intronic
1120043044 14:79775403-79775425 TAATTTCAAGTTAGGGTAGTAGG + Intronic
1121390604 14:93570283-93570305 CAATTTCAAAATAGGGCAGTTGG - Intronic
1121396275 14:93625984-93626006 CATTTGCAAAATGAGGCAGTGGG - Intronic
1122693090 14:103540605-103540627 CTTTTACAAAATAGGACAGTTGG + Intergenic
1123633698 15:22280891-22280913 AAATTTCAAAAGATGTCAGTGGG + Intergenic
1124099540 15:26680461-26680483 CAATTTCATAACAAGGCTGTAGG - Intronic
1124627681 15:31318331-31318353 CCATTTCAGAATAGGGTTGTTGG - Intergenic
1130158605 15:81375876-81375898 ATATTTCAAAATAAGGCAGGGGG - Intergenic
1131842603 15:96453503-96453525 CAATTTCACAATAGTCCAGCCGG + Intergenic
1132413033 15:101599674-101599696 GAACTTAAAAATAGGGCATTGGG - Intergenic
1134883083 16:17764356-17764378 CAATGTTAAAATGTGGCAGTGGG - Intergenic
1137690575 16:50424172-50424194 CCCTTTCAAAATGGGGCAGCTGG + Intergenic
1138922608 16:61550417-61550439 AAATTTCCAAATACGGCATTTGG - Intergenic
1143532197 17:7512024-7512046 GAATTTCTGAATAGGGCAGAAGG + Intronic
1146569405 17:33939853-33939875 CAAGTTGTAAATAGGGCATTTGG + Intronic
1148747303 17:49925858-49925880 CACTTTCAAAATGGGGCCCTTGG - Intergenic
1149143736 17:53465063-53465085 CAGTTTCAAAATATGGTATTAGG + Intergenic
1150860102 17:68792500-68792522 GAATTTGAATATATGGCAGTTGG + Intergenic
1151159894 17:72156596-72156618 GAATTTCAACACAGGTCAGTGGG - Intergenic
1152324810 17:79629458-79629480 CATTTTCAAAATCTGGCAGGTGG - Intergenic
1154420365 18:14223388-14223410 CAATTCCCAGATGGGGCAGTCGG - Intergenic
1157117561 18:44876350-44876372 CCATTTTAAAATAGGGGTGTGGG - Intronic
1159235109 18:65661512-65661534 CAGTTTAGAAAAAGGGCAGTTGG + Intergenic
1159450565 18:68596956-68596978 CAATTTTATAATAGAGCAGCTGG + Intergenic
1162913092 19:13860519-13860541 CAATTTTGAAATAGGGGAGTCGG + Intergenic
1163277564 19:16294968-16294990 AAATTTAAAAGTAGGGCAGGAGG + Intergenic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
925608436 2:5682993-5683015 CAATTTAAAACCAGGCCAGTGGG - Intergenic
925702269 2:6650672-6650694 CATTTTCAAAATAAGGCTGTTGG - Intergenic
926577212 2:14595460-14595482 CAACTTCAAATTATGGCATTTGG - Intergenic
926998216 2:18762324-18762346 CAACTGCTAAATAAGGCAGTTGG - Intergenic
928543276 2:32303775-32303797 CAATTTCAAAAAAAGGCTTTAGG - Intronic
929217086 2:39425735-39425757 CAATTTCAGATTTGGCCAGTTGG - Intronic
929381179 2:41355925-41355947 CTATATCAAAATAGGTCATTTGG - Intergenic
930992192 2:57669783-57669805 AAATTTCAAAATTGAGCAGTAGG + Intergenic
931909695 2:66885213-66885235 GAGTTTCAAAATAGAGCAGAGGG - Intergenic
932369442 2:71175234-71175256 CAATTACAATCTATGGCAGTGGG + Intergenic
932520953 2:72411726-72411748 CAAATGCAAAATAGCTCAGTAGG + Intronic
932626994 2:73305393-73305415 CAGTTTGAAAATATGGTAGTTGG + Intergenic
933313115 2:80685039-80685061 ACACTTCAAAATAGGGCTGTAGG - Intergenic
933904503 2:86876912-86876934 CAATTAAAAAATTGGGCAGAAGG + Intergenic
935972281 2:108541678-108541700 CATTTTCAGAAAAAGGCAGTGGG - Intronic
936367736 2:111875239-111875261 CAATTAAAAAATTGGGCAGAAGG - Intronic
936440140 2:112544128-112544150 TAATTTAAAAATAAGCCAGTCGG + Intronic
937271460 2:120655452-120655474 CAAATCCAAAATATGGCATTAGG + Intergenic
937639507 2:124195522-124195544 CATTTACAAAATCAGGCAGTAGG + Intronic
940738682 2:157482220-157482242 CAATATTAAAATAGAGAAGTTGG + Intronic
940892366 2:159047331-159047353 CAATTTTAAAATGGGGCTGAGGG - Intronic
941366169 2:164613890-164613912 CATTTTCAAACTGGGGCAATTGG - Intronic
942272019 2:174285799-174285821 CCATTTAAAAATTGGGCTGTCGG - Intergenic
942741303 2:179181683-179181705 CAACTACAAAATAAGGCACTTGG + Intronic
942963110 2:181856294-181856316 TAACTTCAAAATATGGCACTAGG - Intergenic
943567271 2:189530840-189530862 CAATTTCTAAATAGAGAAGGTGG + Intergenic
943861362 2:192868011-192868033 AACTTTCAAAATAGGGATGTGGG - Intergenic
944629497 2:201609079-201609101 CAATTTAAAAAAAGGTCATTAGG + Intronic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
945777934 2:214130609-214130631 TAATGTCAAAGCAGGGCAGTAGG - Intronic
947372969 2:229467233-229467255 CAATTTTAAAGAAGAGCAGTGGG + Intronic
948000922 2:234566794-234566816 CAATTTCAACATCAGGCAATTGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174913246 20:54629348-54629370 TAATTTCAAAATAAAGCACTTGG + Intronic
1177561864 21:22766218-22766240 CAATTTCAACATACGGAATTTGG + Intergenic
1177965070 21:27717677-27717699 CAATTTCCAAATCTGGGAGTTGG + Intergenic
1180672301 22:17562553-17562575 CTGTTTCAAAACAGTGCAGTAGG + Intergenic
1181024345 22:20119400-20119422 CAGTGGCAAAAAAGGGCAGTGGG - Intronic
1183447125 22:37864837-37864859 CCATTTTAAAATGGGCCAGTAGG - Intronic
949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG + Intronic
950847852 3:16032046-16032068 CAATGACTAAATAGGGCAGGAGG + Intergenic
951179967 3:19648192-19648214 CCATCTGAAAATAGTGCAGTGGG - Intergenic
951485492 3:23204090-23204112 CAGTTTCAAACCAGGCCAGTGGG - Intronic
954196283 3:48999005-48999027 GAATGTCAAGATAGGGCAGGTGG - Intronic
957299127 3:78368123-78368145 CATTTTCTAAATAAAGCAGTAGG + Intergenic
959777412 3:110183781-110183803 TAATTTCAATATATTGCAGTGGG - Intergenic
961159235 3:124707785-124707807 CAACTTCAAAAAGGGGCACTTGG + Intronic
963772159 3:149398364-149398386 CAACTTCAAAATACGGTAGCTGG - Intergenic
965033778 3:163407862-163407884 CAATTATAAAATAGGCCACTTGG + Intergenic
965716339 3:171607910-171607932 CTATTTTAAAATAGGCCAGATGG + Intronic
966479244 3:180387132-180387154 CATTTTCAAAATAAGTGAGTTGG - Intergenic
970079685 4:12266720-12266742 CAAGTTCAATCTAGTGCAGTAGG + Intergenic
970372524 4:15422528-15422550 AAATTTCCAAATAGCTCAGTGGG + Intronic
971729786 4:30362363-30362385 CCATTTCAGAAAAGGGCATTGGG - Intergenic
972137214 4:35907383-35907405 CAATTTCTAAATGAGGCACTTGG + Intergenic
973583128 4:52364138-52364160 CAAATCCAAAATAGGACAGTAGG - Intergenic
973902629 4:55493332-55493354 AAATTCCAAAGTAGGTCAGTGGG - Intronic
975588207 4:75972482-75972504 TTATTTCAGAATAGGGCAGTGGG - Intronic
976944003 4:90741867-90741889 CAATTTCAAAATACAACAGATGG - Intronic
977776897 4:100931433-100931455 TAATTTAAAAATAGGGAAGCAGG + Intergenic
983619459 4:169745080-169745102 CAATTTCAGAGTAGGGTGGTGGG + Intronic
983706425 4:170665724-170665746 CCATTACAAAATAGAGTAGTAGG - Intergenic
984484847 4:180354993-180355015 CAATTTCCAAATAGGGTGGTAGG + Intergenic
984958914 4:185075105-185075127 TCATTTGAAAATAGGGTAGTTGG + Intergenic
986778668 5:11044486-11044508 CACTTTGAAAATAGGGTAGGAGG - Intronic
986826287 5:11526353-11526375 CAATTTCACCATAGGCGAGTTGG - Intronic
988381396 5:30501030-30501052 CGAATTCAAAATAGGGCAAGAGG + Intergenic
988628644 5:32904920-32904942 AAATTTTAAAATAGTGAAGTGGG - Intergenic
991152250 5:63383939-63383961 CATGTTCAAAATATTGCAGTTGG - Intergenic
995078036 5:108011119-108011141 CACTTTCTAAATAGGAAAGTTGG + Intronic
996218535 5:120898793-120898815 GTATTTCAAAATTTGGCAGTTGG - Intergenic
996949342 5:129107385-129107407 CAAATTAAAAATAGCTCAGTTGG + Intronic
999081135 5:148844621-148844643 CAACTGTAAAATGGGGCAGTTGG - Intergenic
999494521 5:152084028-152084050 CAATTTCAAAACAGAGCCCTAGG - Intergenic
1000186326 5:158861783-158861805 CTATTTCAAAATATGCCACTTGG - Intronic
1000827789 5:166067868-166067890 CAACTTTAAAACAAGGCAGTTGG + Intergenic
1002813613 6:658242-658264 CAGGTTCAAGATAGGGCAGTGGG - Intronic
1003853947 6:10253265-10253287 CAATTTCAACAAAGGGGAATAGG - Intergenic
1004337274 6:14775572-14775594 CAATTTCCAAATAAACCAGTTGG - Intergenic
1004909615 6:20270342-20270364 CAATGTCAAAGTTCGGCAGTGGG - Intergenic
1005041431 6:21603781-21603803 CAGTTTCAATTCAGGGCAGTTGG + Intergenic
1005147711 6:22710568-22710590 CAATTCCTAAATAGGCCAATAGG + Intergenic
1005676555 6:28161503-28161525 GAATTTAAAGATAGTGCAGTTGG - Intergenic
1006744624 6:36332629-36332651 CAATTTCATCTTAGAGCAGTGGG + Intronic
1010249988 6:73697247-73697269 CAGTTGCCAAATAGAGCAGTGGG + Intronic
1012498986 6:99867955-99867977 CAATTTAAAAATATGACAGAAGG + Intergenic
1015170245 6:130244435-130244457 CACCTACAAAATAGCGCAGTAGG + Intronic
1015217235 6:130763986-130764008 CAATTTAAGAAAAGGGCAGCAGG + Intergenic
1016872201 6:148829377-148829399 CATTTTCCAGATAGGGAAGTTGG - Intronic
1017586214 6:155927149-155927171 CAATTTCTAAAGAGGCCAGCTGG + Intergenic
1018069235 6:160147348-160147370 CATTTTCAAAACAAGGCAGTGGG - Intronic
1018406862 6:163494533-163494555 CAATATCAAAAAAGAGCATTTGG - Intronic
1020985685 7:15131625-15131647 TATATTCAAAACAGGGCAGTTGG + Intergenic
1021316382 7:19153095-19153117 CACTTACAAAATTAGGCAGTGGG + Intergenic
1023070817 7:36431242-36431264 CGGTTTCAAATTTGGGCAGTTGG + Intronic
1023411182 7:39890749-39890771 CAAGGTCAAAATAGGGCATGAGG + Intergenic
1025709751 7:63898292-63898314 CAATTTAAAAAGCAGGCAGTAGG + Intergenic
1027598476 7:80207787-80207809 CAAATTCAAAATGAGGCAATAGG + Intronic
1028129586 7:87153461-87153483 CAATTGCACAAAAGGGCACTTGG - Intronic
1030632584 7:111912103-111912125 CAATTACAAAATGGTGCAATGGG + Intronic
1030944791 7:115704558-115704580 CAATTTTAAAGCAGGGCAGCTGG - Intergenic
1031263801 7:119557248-119557270 CTATTACAAAATTGGGCAATGGG - Intergenic
1032655453 7:133924135-133924157 CATCTTCAAAATCTGGCAGTGGG - Intronic
1033116325 7:138628870-138628892 CTATTTCTAAATTGGGCTGTTGG + Intronic
1034607211 7:152328190-152328212 CATTTTCAAAATAAAGGAGTAGG - Intronic
1034999389 7:155600644-155600666 CAATTTAAAAAATGGGCAGAAGG + Intergenic
1035520392 8:271561-271583 CATTTTCTAAATTGGTCAGTTGG + Intergenic
1037180140 8:15995225-15995247 CAATTACAAAAGAGGACTGTGGG + Intergenic
1038193837 8:25348240-25348262 CAATTCCAAAACAGAGCTGTGGG - Intronic
1040721759 8:50332846-50332868 CAGTTACAAAATAGTACAGTTGG + Intronic
1042333158 8:67604042-67604064 CAATTTCAAAATATGTCAGCTGG + Intronic
1043735797 8:83741555-83741577 CAATTTCAAAATACCACAATTGG + Intergenic
1044576676 8:93777383-93777405 CAAATTCAAAAGAGAGCAGAAGG - Intronic
1044912803 8:97079488-97079510 CAATTTTCAAATGAGGCAGTTGG + Intronic
1046140264 8:110082529-110082551 CAATTTCAAACTTGGGCATATGG + Intergenic
1046141201 8:110095049-110095071 GAATTTCAAATTAGGGCAACTGG + Intergenic
1047853256 8:128881813-128881835 AAATCTCAAAATAAGGCAATAGG - Intergenic
1051331456 9:16028715-16028737 CAATTTCAGAATACAGCAGCTGG - Intronic
1051556991 9:18394876-18394898 TAAGTTCTAAATAGGGCTGTGGG + Intergenic
1052062898 9:23983016-23983038 CAATTTAAAAATAGAGATGTTGG + Intergenic
1052750084 9:32481464-32481486 CAAATTCAAAATAGGGAATTTGG - Exonic
1055281046 9:74675112-74675134 CCATTTCAAAAGATGGAAGTTGG + Intronic
1057925830 9:99147670-99147692 CAAGATCATAATAAGGCAGTTGG - Exonic
1058213470 9:102202400-102202422 GAATTTCTAAATAAGTCAGTAGG - Intergenic
1058696101 9:107560210-107560232 AAATTTAAAAATGGGGCAGGAGG + Intergenic
1059404805 9:114093071-114093093 CTATTTCAAACCAGGGCAGAGGG + Intronic
1062348705 9:136128145-136128167 GAATTTCAAAATAGGGCTGATGG + Intergenic
1185974444 X:4703659-4703681 AAATTTCAAAATCAGGCTGTTGG + Intergenic
1186085053 X:5978675-5978697 CTTTTTTAAAATAGGGTAGTGGG + Intronic
1186168086 X:6848362-6848384 TAATTTGAAAATAGGTCTGTGGG + Intergenic
1186608527 X:11115696-11115718 CATTTTCAAAAACAGGCAGTGGG - Intronic
1187666203 X:21612866-21612888 GAATTTCAAAATAAGGCAAAAGG - Intronic
1189074741 X:37904326-37904348 AAACTTGAAAATAGGGCATTGGG + Intronic
1190722939 X:53165560-53165582 TAATTACAAAATAAGCCAGTTGG + Intergenic
1191946309 X:66538685-66538707 CAAAATCAAAATAGGCCACTAGG - Intergenic
1192008375 X:67241463-67241485 CAATTTCAAAACATGGCAATTGG + Intergenic
1193093523 X:77521327-77521349 AAATTTAAAAAAATGGCAGTAGG + Intronic
1193692839 X:84668326-84668348 CAATTCCAAAGGAGGGCTGTTGG + Intergenic
1194334973 X:92634432-92634454 CAAGTTCAAAATAGGTCATAAGG - Intergenic
1194445182 X:93978393-93978415 CACTTTCATAATGGCGCAGTGGG + Intergenic
1194754323 X:97719813-97719835 GATTTACAAAATGGGGCAGTTGG + Intergenic
1197291375 X:124662522-124662544 TAATTTGACAAAAGGGCAGTTGG - Intronic
1197586856 X:128358835-128358857 CAGTGTCACAATAGGGCACTGGG + Intergenic
1197614966 X:128680801-128680823 CTATATCAAAATAGGGCAAGGGG - Intergenic
1198294805 X:135276189-135276211 TAATTTCAAAATAAGGAAGTGGG - Intronic
1200383289 X:155862394-155862416 CAAAGTCAAAATAAGGAAGTAGG - Intergenic
1200643452 Y:5751483-5751505 CAAGTTCAAAATAGGTCATAAGG - Intergenic
1202305074 Y:23460553-23460575 AAATTTCAAAAGATGGCAGTGGG + Intergenic
1202565735 Y:26210036-26210058 AAATTTCAAAAGATGGCAGTGGG - Intergenic