ID: 1121393786

View in Genome Browser
Species Human (GRCh38)
Location 14:93599904-93599926
Sequence CATTAAAACCAGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121393786 Original CRISPR CATTAAAACCAGATGCAGCT GGG Intronic
901822192 1:11837314-11837336 CACAAAAACCAGATGCTGCCTGG - Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
904734394 1:32619522-32619544 CAATAAAACCAAATAGAGCTGGG - Intronic
906138115 1:43514780-43514802 AATTTAACCAAGATGCAGCTGGG + Intergenic
907247857 1:53119645-53119667 CATTAAAATCATAGTCAGCTGGG - Intronic
907966250 1:59332574-59332596 CATTTAAACCTGATCTAGCTAGG - Intronic
911523520 1:98957733-98957755 CATTAAAACCATATGAAACTAGG + Intronic
913252607 1:116924439-116924461 CTTTAAAACTACATGCAGGTTGG - Intronic
916685111 1:167137189-167137211 CTTTAAAATCAGATATAGCTAGG - Intergenic
916697349 1:167252498-167252520 CATTAAAAACAGATTCAGGCCGG - Intronic
916842370 1:168613626-168613648 TAATAAAAACAGATGCAGATTGG - Intergenic
917975729 1:180236368-180236390 CATTAAAATCCGAGGCAACTGGG - Intronic
919103076 1:193117520-193117542 AATTAAAACCACAAACAGCTGGG + Intergenic
919683150 1:200455625-200455647 AATTAAAACTAGATCCAACTGGG - Intergenic
923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG + Intergenic
923705078 1:236337389-236337411 CACTAAGACCACCTGCAGCTGGG + Intergenic
924418816 1:243887825-243887847 CCTTAAAACTAGAGGCGGCTGGG + Intergenic
1064766846 10:18683926-18683948 CTTTAGAACCACATGCATCTGGG - Intergenic
1067242861 10:44510804-44510826 CCAGAAAACAAGATGCAGCTAGG + Intergenic
1071589351 10:86857529-86857551 GATTAGAACCACATCCAGCTAGG - Intronic
1073172256 10:101520346-101520368 CATTAAAAACAGAAGCAGCCAGG - Intronic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074743949 10:116512564-116512586 CATTTACACCAGATGAAGCAAGG - Intergenic
1077981807 11:7308544-7308566 CATTAAATCCATTTGCATCTTGG - Intronic
1078589662 11:12628465-12628487 CATTGAGACCAGATGTAGCTGGG - Intergenic
1080593220 11:33742462-33742484 CATTAAAACCATACTGAGCTGGG - Intronic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1082809846 11:57473238-57473260 CATAAAAATCAGATGCAGATGGG + Intronic
1085311832 11:75521368-75521390 CAATTCAAACAGATGCAGCTTGG + Intronic
1086146985 11:83562873-83562895 CTTAAAGACCAGATGCAGATTGG - Intronic
1087306365 11:96493780-96493802 CATTAAAACCAGTGGCAGTATGG + Intronic
1089610092 11:119664241-119664263 CAGTGAAATCTGATGCAGCTGGG - Exonic
1090140875 11:124259422-124259444 AAATAAAACCACATGCAGTTTGG + Intergenic
1091501115 12:1018970-1018992 CATGGAAACCAGAGACAGCTTGG + Intronic
1091530711 12:1352451-1352473 CATTCAAACCATTTGCAGTTTGG - Intronic
1093277103 12:17142733-17142755 AATTAAAATCAAATTCAGCTCGG - Intergenic
1093542163 12:20300123-20300145 CATTAGAACCAGACACAGCAAGG - Intergenic
1093799411 12:23354559-23354581 AATTAAAAGAAGATTCAGCTTGG - Intergenic
1095912607 12:47444080-47444102 CATTAAGGCCAGGTGCACCTGGG + Intergenic
1096695502 12:53345738-53345760 CATTAAAAAGAGAAGCAGATAGG + Intergenic
1100512492 12:95290379-95290401 AACTAAAACTAGAAGCAGCTAGG + Intronic
1102804119 12:115764323-115764345 CATTAGAATCACATGGAGCTGGG - Intergenic
1104138299 12:125961369-125961391 CATTAAAGCCAGATGGAATTGGG - Intergenic
1104574200 12:129951757-129951779 AATGAAAACCAGAATCAGCTAGG + Intergenic
1108086664 13:46800228-46800250 AATTGAGGCCAGATGCAGCTGGG - Intergenic
1112692619 13:101915355-101915377 CATTTAAAACAAATACAGCTGGG + Intronic
1112833056 13:103477376-103477398 CATTGAAATGAGATGCCGCTGGG + Intergenic
1113470940 13:110545604-110545626 TATTAAAACTAGAAGGAGCTTGG + Intronic
1114202872 14:20539227-20539249 CCATAAAAACACATGCAGCTAGG - Intergenic
1114458115 14:22870256-22870278 TATTCAAAACAGATGCGGCTGGG + Intergenic
1115396394 14:32913726-32913748 CATTAAAACCATAACCAACTAGG - Intergenic
1117615616 14:57531039-57531061 CATCAAAATCAGATGTAGCCAGG - Intergenic
1117741285 14:58821732-58821754 CATCAGAACCAGATGGAACTGGG - Intergenic
1117864956 14:60137401-60137423 AAGAAAAACCAGATGCAGTTAGG + Exonic
1118404255 14:65408143-65408165 TATTAAAACCAGATGAAAATGGG + Intergenic
1120713165 14:87814203-87814225 CATTACAATCTGATGCATCTTGG - Intergenic
1121393786 14:93599904-93599926 CATTAAAACCAGATGCAGCTGGG + Intronic
1125696259 15:41639847-41639869 CATAAAAACCACATGCTCCTGGG - Intronic
1127581561 15:60343478-60343500 CATTACAGCCTGATACAGCTTGG - Intergenic
1127891961 15:63260126-63260148 CATAAAAATCAGAAGCAGCTGGG - Intronic
1130737822 15:86569134-86569156 TATGAAATCCAGATGCTGCTGGG + Intronic
1130877857 15:88029754-88029776 AATTAAAGCCACATGCATCTTGG - Intronic
1131129450 15:89887171-89887193 CATCTAAAACAGATGCATCTCGG - Intronic
1131359432 15:91776978-91777000 CATTAAAGGCAGGTGCAGCCTGG + Intergenic
1133576639 16:7097653-7097675 GATCAAAACCAGATGCAGAGAGG - Intronic
1138406222 16:56796375-56796397 AAGTTAAACCATATGCAGCTTGG + Intronic
1138452233 16:57100198-57100220 CAGTAAAACCAAATGCAGCCGGG - Intronic
1140598998 16:76452037-76452059 CATTTTTACCAGCTGCAGCTTGG - Intronic
1141265122 16:82489634-82489656 CATTACAACTAGAGGCAGGTTGG - Intergenic
1142570673 17:871696-871718 TATCAAAAGCAAATGCAGCTGGG - Intronic
1146998015 17:37337800-37337822 CTTTAAAACTAGAATCAGCTGGG + Intronic
1148423624 17:47570446-47570468 AATTAATAGAAGATGCAGCTAGG - Intronic
1149616990 17:58008853-58008875 CATGAAAACTAGATGAGGCTGGG + Intergenic
1153091865 18:1356271-1356293 CATTAAGACTAGAAACAGCTGGG + Intergenic
1155250685 18:23950631-23950653 CTTTAAAACCAGATTCTTCTAGG + Intronic
1155762755 18:29588216-29588238 GATTAGAAGCAGCTGCAGCTGGG + Intergenic
1157290080 18:46403580-46403602 CATGAAAATCAGATCCGGCTGGG + Intronic
1157517163 18:48318964-48318986 TATTAAAATAAAATGCAGCTGGG - Intronic
1157719899 18:49915675-49915697 AATTAAAACAATATGTAGCTAGG - Intronic
1158681111 18:59567587-59567609 CATTAAAACCCGATCCACTTGGG - Intronic
1164914923 19:32044873-32044895 CAGTAAAACCAAACCCAGCTTGG + Intergenic
1166239961 19:41483978-41484000 CATTAAAACCACATTGAGGTTGG + Intergenic
1167734352 19:51282810-51282832 CCTAAAGACCAGATGCAGATGGG + Intergenic
1168015450 19:53569262-53569284 GATTAAAACGAGGTGCATCTGGG - Intronic
931827581 2:66017686-66017708 CAATAAAACTAGATGCATTTTGG + Intergenic
934869825 2:97853297-97853319 CATTAAGAACATTTGCAGCTGGG + Intronic
937618428 2:123955325-123955347 CATTCAAACCAGATTCTGATTGG - Intergenic
939666337 2:144956754-144956776 CAATAAAACCATATTCAACTAGG - Intergenic
940261021 2:151779875-151779897 CCTTACATCCAGACGCAGCTGGG + Intergenic
940778195 2:157906166-157906188 CATTAAAACCACATGGAGTGTGG - Intronic
940982826 2:160022636-160022658 CTTTTAAACCAAAGGCAGCTGGG + Intronic
942082444 2:172413381-172413403 CATTCAAAGAACATGCAGCTGGG + Intergenic
942273028 2:174296535-174296557 CATCAAAAACAGTTCCAGCTGGG + Intergenic
942343575 2:174976531-174976553 AAGCAAAACCAGAAGCAGCTGGG - Intronic
943474155 2:188333820-188333842 CCTTAAGACCAGCTGCAGTTCGG + Intronic
943999340 2:194812345-194812367 CAGTAACAGCAGATGCTGCTAGG + Intergenic
944388597 2:199192434-199192456 AATTAAAAGTAGAAGCAGCTGGG - Intergenic
945514829 2:210750181-210750203 CTTTAGAATCAGATTCAGCTGGG + Intergenic
947510170 2:230745564-230745586 TCTTAAAAGCAGATGAAGCTGGG + Intronic
948494061 2:238334373-238334395 CATTTAATCCTGATGCAGGTTGG + Intronic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1169865517 20:10195754-10195776 AATTAAATCCAGATGCAGGAAGG + Intergenic
1170692783 20:18630232-18630254 CATTGAAACTAGAGGCAGTTGGG - Intronic
1171079652 20:22165782-22165804 CCTTAAAGTCAAATGCAGCTTGG - Intergenic
1171091775 20:22292153-22292175 CATTAAAAGGAGATGCATCTTGG - Intergenic
1172958343 20:38778457-38778479 CATCAAAACCTGATGCAGGCCGG - Intergenic
1173162241 20:40661677-40661699 CATGAAAATCATATGCAGCCTGG - Intergenic
1173942520 20:46923749-46923771 CATTAACAGCAGATGCATCTGGG + Intronic
1180694884 22:17745362-17745384 CATTAAAACAATTTGCTGCTGGG - Intronic
1182186906 22:28413553-28413575 CACCAATACCAGAGGCAGCTTGG + Intronic
1183836838 22:40461355-40461377 ACTTAAAACCAAATCCAGCTGGG + Intronic
1183958878 22:41398885-41398907 CATGAAAACCAGATGCTCCTCGG - Exonic
1184570025 22:45316998-45317020 CATTGTAATCAGATGCTGCTTGG + Intronic
1184882652 22:47320482-47320504 CATAAAAAACAAATGCACCTAGG - Intergenic
951788988 3:26458969-26458991 TATTAAAATTAGATGCAACTAGG + Intergenic
951912812 3:27769097-27769119 AATCTAAACCAGATGCAACTTGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954159148 3:48707732-48707754 CATTAAAACCAGAATGAGCCTGG - Intronic
954348011 3:50017119-50017141 AATTAAAACCATAAGGAGCTGGG - Intronic
955702009 3:61691114-61691136 CTTTAAAACAAGTTGCAGTTTGG + Intronic
955741609 3:62096841-62096863 CATTAAAGCCCAATGCAGCTAGG - Intronic
958052515 3:88366367-88366389 ACTGAAAACCAGATGAAGCTGGG + Intergenic
959683078 3:109118006-109118028 GATGAAATCCAGACGCAGCTGGG + Exonic
960338797 3:116449861-116449883 CATGAAATCCAGATGCAGCCTGG + Intronic
961215477 3:125156685-125156707 GATGAAGACCAGATGCAGTTTGG - Intronic
962051403 3:131819533-131819555 CCTTAAAACCAAATCCTGCTTGG + Intronic
964110334 3:153080908-153080930 CATTAAGAACAGCTTCAGCTTGG - Intergenic
964535194 3:157713877-157713899 CTTTCAAATCAGATGCAGTTTGG + Intergenic
964543811 3:157810368-157810390 CATTAAAAACAAATGAATCTGGG + Intergenic
965711474 3:171560059-171560081 CAGTTCAACCAGATGCAGCAAGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
970993213 4:22236642-22236664 CATTAAAACCAGGTGAAGCCAGG - Intergenic
971173953 4:24262725-24262747 CACTAAAACCACATCCTGCTGGG - Intergenic
972292403 4:37701890-37701912 CATTAAAAGCACATGGGGCTGGG - Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
974780052 4:66543294-66543316 CATTAAAACCAGTTCTAGCCAGG + Intergenic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
979447253 4:120828756-120828778 TATTAATATCAGATGTAGCTAGG - Intronic
982095883 4:151923053-151923075 AATTAAAAGCAGATGCTGCTGGG + Intergenic
987688534 5:21236914-21236936 CACTAGTACCAGATGCTGCTTGG - Intergenic
988612854 5:32744285-32744307 CATTAAAACATGATGCAGGCTGG - Intronic
993312421 5:86351419-86351441 AATTAAAACAACATGCAACTTGG + Intergenic
995235647 5:109826664-109826686 CATTAAAACCACAATCAGCCAGG - Intronic
996313851 5:122139060-122139082 CATTAAAATCAGATAAATCTTGG + Intronic
998073743 5:139219356-139219378 CATTAAAATCACATGGGGCTAGG + Intronic
1000553714 5:162697177-162697199 CTTTAATACCAGATACAGGTAGG - Intergenic
1001152247 5:169242264-169242286 CATTAGAAACACAGGCAGCTGGG - Intronic
1001640901 5:173243568-173243590 TTTTAAAACCAGTGGCAGCTTGG - Intergenic
1002837533 6:877709-877731 CCTCAAAACCACCTGCAGCTGGG - Intergenic
1003439923 6:6130902-6130924 CAATAAAAGCAGATGCAGTCTGG - Intergenic
1003895236 6:10601168-10601190 CATAAATAACAGAAGCAGCTGGG + Intronic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1006669335 6:35720026-35720048 CTTTAAAACTAGAAGCAGCTCGG + Intronic
1007881189 6:45168618-45168640 ATTTAAAAACAGATGCAGCCAGG - Intronic
1007982048 6:46169994-46170016 CATTAAACACAGTTGCAGCAAGG + Intronic
1008722409 6:54372285-54372307 CATTAAAACTAGTTGAGGCTGGG - Intronic
1011007656 6:82665245-82665267 GAGGAAAACCAGATGAAGCTAGG + Intergenic
1012556180 6:100515018-100515040 CTTTAAAACCAAATGCAAATTGG - Intronic
1015213866 6:130727633-130727655 CATTAAAAGGATATGCAGCAGGG - Intergenic
1016311747 6:142740611-142740633 CAATAAAAACAAATGCTGCTGGG - Intergenic
1017961041 6:159220851-159220873 CTTTTCAACCAGATGCAGATAGG - Intronic
1019988119 7:4673124-4673146 TTTTAAAACTAGCTGCAGCTGGG + Intergenic
1020221039 7:6237412-6237434 TATTAAAAACACATGCAGCCCGG + Intronic
1022038736 7:26559038-26559060 CATTAAAAACAGAAGCAGAGTGG - Intergenic
1022429484 7:30302237-30302259 CATTTAAGCCATGTGCAGCTTGG - Intronic
1025050916 7:55733923-55733945 CATTAAAACGAGATGGAATTTGG - Intergenic
1026079571 7:67205623-67205645 CATTATAACCAGGTGAAGGTGGG + Intronic
1029066542 7:97855136-97855158 CTTTAAAACTAGTTACAGCTGGG - Intronic
1030313365 7:108089974-108089996 TTTTGAAACCAGATGCACCTGGG + Intronic
1030395855 7:108985952-108985974 CATCTAAACCAGATGAGGCTGGG - Intergenic
1031310959 7:120196439-120196461 CAGTTAAACCAGACGCAACTTGG - Intergenic
1031700672 7:124921235-124921257 TGTCAAAACTAGATGCAGCTTGG + Intronic
1032948965 7:136885788-136885810 TATTAAACCAAGATCCAGCTGGG - Intronic
1034508581 7:151517066-151517088 CTTTAAAATCAAATGCGGCTGGG + Intronic
1035066237 7:156107076-156107098 CATTAAAAACAGTTGCAGCCCGG - Intergenic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1039313411 8:36344707-36344729 CATTAAAAGCAAATTCAGCTTGG - Intergenic
1040711291 8:50192209-50192231 GAACAAAACCAGAAGCAGCTTGG + Intronic
1041499086 8:58519932-58519954 CATTAAAGCCAGATCTACCTTGG + Intergenic
1041530476 8:58860176-58860198 CATTAGAAACAGTGGCAGCTAGG - Intronic
1043936276 8:86146398-86146420 CATTAAAAAAAAATCCAGCTAGG + Intronic
1044668914 8:94658849-94658871 CACTAAAACAAGGTGCACCTGGG - Intronic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045354994 8:101378212-101378234 CAATAAAACCAAAAGCAGCTAGG - Intergenic
1046535267 8:115500867-115500889 CATTAAAACCAAGTTCAGGTCGG - Intronic
1047364277 8:124197958-124197980 CATTAAATCCGGAAGCTGCTAGG - Intergenic
1049860318 8:144893863-144893885 CATAAACACAAGATGCAGGTAGG - Intronic
1051429171 9:16964532-16964554 AATTAAAAACAGCTGCATCTAGG + Intergenic
1058951775 9:109910715-109910737 GACTAAAAGCAGATGCAGCAGGG + Intronic
1059371889 9:113847754-113847776 CATTAAATCCAGATGTGGCATGG + Intergenic
1187408646 X:19026794-19026816 CATTACAAACAGATGCCCCTTGG - Intronic
1188046345 X:25429276-25429298 CATTAAATGCAGAATCAGCTTGG - Intergenic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1193878120 X:86887417-86887439 CATTAAAGCCAGATTCTGCTGGG + Intergenic
1196603310 X:117626531-117626553 CATTAAAACCATAATCAGATTGG + Intergenic
1197803116 X:130372784-130372806 ATTTTAAAGCAGATGCAGCTTGG + Intronic
1197999983 X:132423746-132423768 GAAGTAAACCAGATGCAGCTGGG - Intronic