ID: 1121396478

View in Genome Browser
Species Human (GRCh38)
Location 14:93628211-93628233
Sequence GTTGAGAGCCAATGAGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121396478 Original CRISPR GTTGAGAGCCAATGAGGACT AGG (reversed) Intronic
900693441 1:3995556-3995578 GTTGACAGCCAATGGAGACCGGG - Intergenic
901757224 1:11448766-11448788 GTTTAGAGCCAGGGAGGCCTGGG + Intergenic
903113357 1:21157293-21157315 CTTGAAAGTCAGTGAGGACTAGG - Intronic
904450392 1:30607200-30607222 GTAGAGATCCAAAGAGGGCTAGG + Intergenic
909608478 1:77530397-77530419 GGTGAGAGCAAATGAGAAATAGG + Intronic
911097151 1:94064261-94064283 GTTGAGAGCTAATGAGGGAGAGG + Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
915486989 1:156228358-156228380 CTTGAGAGCCAATGCAGAATTGG - Intronic
915556535 1:156663925-156663947 GTTGTGAGCCAAGGAGGCCAAGG + Intergenic
916279393 1:163032441-163032463 GAAGAGGGCCCATGAGGACTGGG + Intergenic
916310671 1:163395378-163395400 CTTGAGAGACACTGAGCACTTGG + Intergenic
920169183 1:204059677-204059699 TTTGAGAGCCAAGGAGTACATGG - Intergenic
921533422 1:216313367-216313389 GTTCACAGCCAATGAGCACAGGG - Intronic
922657305 1:227396954-227396976 TTTGAGAGGGAATAAGGACTTGG - Intergenic
1063186469 10:3656391-3656413 GTTGAGAGCCAAACAGAGCTCGG + Intergenic
1067361868 10:45589533-45589555 TTTGACAGCTAAAGAGGACTAGG - Intronic
1069777866 10:70937318-70937340 GGCGAGAGCCACTTAGGACTGGG + Intergenic
1070175850 10:73968560-73968582 GTTGAGAGCCAACTCGGGCTGGG - Intergenic
1071536763 10:86439698-86439720 GCTGTGAGCCAAGGAAGACTGGG + Intronic
1073618254 10:105020330-105020352 AAGGAGAGCCAATGAAGACTTGG - Intronic
1077000535 11:320053-320075 GGGGAGAGCCAATGAGGAGACGG - Intronic
1079284455 11:19116844-19116866 ATTGAGAGCAAATCTGGACTTGG - Intergenic
1081625946 11:44655123-44655145 GTTGAGAGGCATTCAGCACTGGG - Intergenic
1084394447 11:68899527-68899549 CTTGAGAGACAAGGAGGACAAGG + Intronic
1085826448 11:79852920-79852942 TTTGAGAGCTAATGAGGCCCAGG + Intergenic
1090458324 11:126868433-126868455 GTGGAGAGCAAAGGAGGGCTGGG + Intronic
1091899655 12:4134572-4134594 GCTGATAGCCAATCAGGAATTGG - Intergenic
1092146829 12:6220430-6220452 GTGACGAGCCAGTGAGGACTTGG + Intronic
1093187199 12:16034203-16034225 GTTGAGAACAAAACAGGACTGGG - Intronic
1093225309 12:16476065-16476087 GTCTAGACCCAGTGAGGACTTGG + Intronic
1095226711 12:39686214-39686236 GTGGAGAGGCAATGTGGAATTGG - Intronic
1095622137 12:44269743-44269765 GTTTTGACCCAATGAGGACTTGG - Intronic
1096744333 12:53715671-53715693 GTTGAGAACCTTAGAGGACTTGG - Intronic
1097221418 12:57453353-57453375 ATTTAAAGCCAGTGAGGACTGGG + Intronic
1097547968 12:61028675-61028697 GTTGAGAGCCCACCAGGACCAGG - Intergenic
1101437555 12:104677136-104677158 TTTGAGAGCCAATTAGGACCAGG - Intronic
1101800926 12:108021457-108021479 TTTGAGAGCCAGTGATGGCTGGG - Intergenic
1102465591 12:113129279-113129301 GGGGAGAGACAATGAGGACAAGG + Intronic
1103196999 12:119052843-119052865 GTTGAGAGACAGAGAGGACGTGG + Intronic
1103235018 12:119364892-119364914 GATGAGAGCCAAGGATGACTGGG + Intronic
1105069167 12:133223976-133223998 TTTTAGAACAAATGAGGACTCGG + Intronic
1105996972 13:25681872-25681894 GTTGAGAACAAACGAAGACTTGG + Intronic
1108229276 13:48319865-48319887 GGTGAGATCCAGTGAGGACTAGG - Intronic
1108494935 13:51016158-51016180 GTAGAGAGCAACTGAGTACTTGG - Intergenic
1112353655 13:98656874-98656896 GTTAAGAGCAAGTGAGGGCTGGG + Intergenic
1112440521 13:99421540-99421562 GGAGAGAGACAGTGAGGACTGGG - Intergenic
1117376309 14:55121310-55121332 GATCAAAGCCAATGAGGATTAGG - Intergenic
1118948589 14:70412781-70412803 GCTGAAACCCATTGAGGACTCGG + Intronic
1119345695 14:73921996-73922018 GTTGAAAGAAAATGAGGACCAGG + Intronic
1121396478 14:93628211-93628233 GTTGAGAGCCAATGAGGACTAGG - Intronic
1121714353 14:96062343-96062365 GTTGAGGGTGAAAGAGGACTAGG - Intronic
1139331494 16:66195832-66195854 GCTCAGAGCCACTCAGGACTGGG - Intergenic
1142105153 16:88298713-88298735 CTGGAGAGCCAGTGAGGAGTGGG - Intergenic
1147402349 17:40188530-40188552 ATTGAGAGCTCTTGAGGACTGGG - Intronic
1148476053 17:47929354-47929376 GAGGAGAGCCAATGGGGCCTTGG + Intergenic
1148999482 17:51742284-51742306 ATTGAGAGGAAATGAGGATTGGG - Intronic
1149636795 17:58177319-58177341 GTTGAGGGACAAGGTGGACTTGG + Intergenic
1150462567 17:65364744-65364766 GGTGAGAGCAAATCAGGCCTCGG - Intergenic
1155530437 18:26760998-26761020 GGTGTGAGCCACTGTGGACTGGG + Intergenic
1158224207 18:55183655-55183677 GTTGTAAGCCATTGAGCACTGGG + Intergenic
1158745336 18:60193571-60193593 TTTGAGAGCTAAGGAAGACTAGG - Intergenic
1159224823 18:65520288-65520310 GTAGAGAGTCAATAAGGACTTGG - Intergenic
1161597065 19:5156029-5156051 TTTGAGAGCCAAGGTGGACCTGG - Intergenic
1162614214 19:11784223-11784245 TTTGAGAGCCACTGAAGATTAGG - Intergenic
1164743247 19:30592462-30592484 GTTTAGAGCAAAGGAGGCCTTGG - Intronic
1167285322 19:48596024-48596046 GTTGGGAGCCAGTGAGGAGCAGG + Intronic
1168613496 19:57819651-57819673 CGTCAGAGCCAATGAGGGCTCGG + Intronic
1168617389 19:57849780-57849802 GGTCAGAGCCAGTGAGCACTCGG + Intronic
1168625774 19:57916649-57916671 GGTCAGAGCCAATGAGCACTCGG - Intergenic
928088120 2:28358358-28358380 GTAGAGAGCCCATGAGAACCTGG + Intergenic
929139006 2:38651051-38651073 ATTGAGACTCAAAGAGGACTGGG - Intergenic
932102854 2:68916430-68916452 GCTGACAGGCAAAGAGGACTGGG + Intergenic
932309060 2:70725311-70725333 GTTGAGCGCAAGTGAGGACCTGG + Intronic
932433201 2:71687574-71687596 GTGAAGAGCCAAGGAGGACTGGG - Intergenic
936609873 2:113991857-113991879 GGTGGAAGCCATTGAGGACTTGG + Intergenic
938258888 2:129881265-129881287 ATGGAGCTCCAATGAGGACTGGG + Intergenic
939555757 2:143670687-143670709 AATAAGAGACAATGAGGACTTGG - Intronic
939580972 2:143945465-143945487 GTTCAGAGTCTATGAGGCCTGGG - Exonic
942032185 2:171973549-171973571 GTCCAGAGCCTATTAGGACTGGG + Intronic
942889518 2:180971244-180971266 GTTGACAGCCAGTGAAGAGTGGG - Intronic
948226211 2:236311176-236311198 ATTGAGAGGCAGTGAGGCCTTGG - Intergenic
1169737650 20:8854326-8854348 GTTCAGAGCCCCTGAGGCCTGGG - Intronic
1170579044 20:17684201-17684223 GCTGTTAACCAATGAGGACTGGG - Intergenic
1173642535 20:44614032-44614054 GCTGAGAACCAAGGAGGACGAGG - Intronic
1173732594 20:45339088-45339110 GATAAGAGCCATTTAGGACTAGG + Intronic
1175579977 20:60090865-60090887 TTTGGTAGCCAATGAGCACTAGG - Intergenic
1179395244 21:41033657-41033679 GTTCAAAGCCACTGAGGACTGGG + Intergenic
1180753110 22:18139130-18139152 GGTGACAGACAATGAAGACTTGG - Intronic
1182072963 22:27476264-27476286 GGTGAGAGCCCAGGAGGAATGGG + Intergenic
1183264139 22:36815451-36815473 CTTGAGAGCCAGGGAGGTCTGGG - Intronic
1184346118 22:43914237-43914259 GTTGAGAGCTACTGTGGACTAGG + Intergenic
949726848 3:7058803-7058825 GTTGCTAGCCAATCAGGACAAGG - Intronic
961506324 3:127372547-127372569 GCTGAGAGCCAAGGAGTATTGGG - Intergenic
962846600 3:139279259-139279281 GTTGGGAGCTGATGAGGATTGGG + Intronic
963226855 3:142871250-142871272 GATGAGAGATAATGAGGGCTTGG - Intronic
963982176 3:151550954-151550976 AGTGAGAGCCAATGGGGACAAGG - Intergenic
965350620 3:167607609-167607631 GTTGACAGCCACACAGGACTGGG - Intronic
968567054 4:1318549-1318571 GTGTGGAGCCCATGAGGACTGGG + Intronic
972866155 4:43235805-43235827 GTTGAGAACCAAGGAGGCCGAGG - Intergenic
973555679 4:52080123-52080145 GGAGAGAACTAATGAGGACTTGG + Intronic
973576440 4:52294457-52294479 CTGGAGAGCCAATGATGGCTTGG + Intergenic
974515463 4:62902458-62902480 GGTAAGAGCGAATGAAGACTAGG + Intergenic
976146942 4:82051340-82051362 GTGGAGAGCCAATGTTCACTTGG + Intergenic
977321479 4:95521578-95521600 TTTGAGAGGTAATTAGGACTAGG - Intronic
980557462 4:134428354-134428376 GTTGAGAGCTATTGATGACTTGG - Intergenic
981192984 4:141885271-141885293 GATGAGAGACAATGAGGGCAAGG + Intergenic
984795749 4:183658931-183658953 GATGAGTGCCAACGAGGACCAGG - Exonic
985838306 5:2287158-2287180 TTCGAGTGCCAATGAGGACTTGG - Intergenic
992192414 5:74306631-74306653 GTTGATTGCCAATGAGGTTTTGG - Intergenic
1001249392 5:170134999-170135021 GGTGAGGGCCAAGGAAGACTAGG + Intergenic
1003277495 6:4665011-4665033 GTTCAGAGACAAGAAGGACTGGG - Intergenic
1004295621 6:14407260-14407282 GTTGAGAGTCTATGGGGGCTGGG - Intergenic
1008226644 6:48927026-48927048 GTAGAAAGCCCATGAAGACTAGG + Intergenic
1009294874 6:61933615-61933637 GTTTAGAGCCTATGAGCAATAGG - Intronic
1013670748 6:112399790-112399812 GTAGAGAACCAATTAGGAATGGG + Intergenic
1014844871 6:126262652-126262674 ATTTAGGGCCTATGAGGACTGGG + Intergenic
1021914655 7:25419377-25419399 GGTGAGAGCTAATGAGGATGGGG - Intergenic
1022464989 7:30647706-30647728 GTCGAGAGCCATTGAGGCCTGGG + Intergenic
1023407848 7:39855035-39855057 GATGAGTGCCAACGAGGACCAGG - Intergenic
1027499531 7:78931413-78931435 TTTGAGAGCCAGTGAGCAATTGG + Intronic
1028129888 7:87158194-87158216 GTTGGGATACAATAAGGACTTGG - Intronic
1028883463 7:95906212-95906234 GTTGTGAGCCAAAGAGACCTGGG + Intronic
1029271889 7:99381913-99381935 GCTGGGAGCCAACCAGGACTGGG - Intronic
1029570650 7:101366394-101366416 GTTGACAGGCAATGATGACAGGG + Intronic
1029970668 7:104785694-104785716 GTTGAGAAATCATGAGGACTTGG - Intronic
1032488961 7:132309573-132309595 CCTGCGAGACAATGAGGACTGGG + Intronic
1042825325 8:72973749-72973771 GTTAAGAGCCAAGGAGTAGTAGG - Intergenic
1043682637 8:83048940-83048962 TTTGAGAGACAATGAGGTCATGG + Intergenic
1046306282 8:112371396-112371418 CCTGAGAACCAATGAGTACTGGG + Intronic
1047711297 8:127555177-127555199 GGTGAGAGACAAGGAGGAATGGG + Intergenic
1048055253 8:130856560-130856582 CCTAAGAGACAATGAGGACTAGG - Intronic
1048787344 8:138064022-138064044 GGTGAGAGACAATGGGGGCTGGG + Intergenic
1050485027 9:6125154-6125176 GTGGAAAGCCCAAGAGGACTAGG + Intergenic
1055383542 9:75735741-75735763 ATTGAGAACCAAAGATGACTAGG - Intergenic
1059453585 9:114386323-114386345 CTTGAGAAACAATGAGGATTTGG + Intronic
1059696608 9:116735781-116735803 GAGAAGAGCCTATGAGGACTGGG + Intronic
1186381155 X:9060815-9060837 GATGAGAGCACATGAGGAGTTGG + Intronic
1186388424 X:9133491-9133513 ATTGAGAGCCCATGAATACTTGG - Intronic
1187167164 X:16814752-16814774 GTTGATAGCTAAGGAGAACTGGG + Intronic
1187637755 X:21250904-21250926 GTTGTAAGCCAATGAGAATTGGG - Intergenic
1190472560 X:50797554-50797576 GATGAGAGACAAGGATGACTGGG + Intronic
1192048430 X:67700698-67700720 GTATAGTGCCAATGAGAACTTGG - Intronic
1196963756 X:121032677-121032699 GTGGACAGCCAATGAGGAAATGG - Intergenic
1200135907 X:153874567-153874589 GTTGGGAGGCAGTGAGGGCTTGG - Intronic