ID: 1121397294

View in Genome Browser
Species Human (GRCh38)
Location 14:93637325-93637347
Sequence CTGTAAAAGCTGAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121397291_1121397294 18 Left 1121397291 14:93637284-93637306 CCATTGAGGATGAGAGGTTAGTT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG 0: 1
1: 0
2: 3
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121397294 Original CRISPR CTGTAAAAGCTGAAGGAGAC TGG Intronic
900907335 1:5568777-5568799 CTGTAAAAGCTGCAGAAGTGGGG + Intergenic
902054648 1:13590249-13590271 CTGTAAATGCTTAAGGGGACAGG - Intronic
902645283 1:17793593-17793615 CTGGAAAAGCTGTAGGGGAAGGG - Intronic
902961236 1:19964174-19964196 CTCTAAAAGATAAAGGAGGCAGG + Intergenic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
906318769 1:44804149-44804171 CTTCAAATCCTGAAGGAGACAGG - Exonic
906837836 1:49103110-49103132 CTGAAAATGCTGAGGGAGATTGG - Intronic
907124102 1:52033852-52033874 CTGTAAAAGTCAAGGGAGACAGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907630978 1:56081463-56081485 CTGTGACAGCTGATGGAAACCGG + Intergenic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
908649076 1:66312379-66312401 CTCTAGAAGCTGGAAGAGACAGG - Intronic
910599324 1:89013728-89013750 CTGTAAAATATGAAGGACAATGG - Intronic
912076540 1:105883020-105883042 CTCTAAAAGCCGGAGGAGAGTGG - Intergenic
912172991 1:107123393-107123415 ATGTTACAGCTGAAGGAGCCAGG - Intergenic
912297947 1:108488274-108488296 CTCTACAAGCTGAAAGAGAGTGG + Intergenic
912548379 1:110467410-110467432 CAGTCCCAGCTGAAGGAGACAGG - Intergenic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
913241574 1:116834754-116834776 CTGTCTAAGCTGAAAGAAACAGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
915552999 1:156646099-156646121 CTGCTAAAGCTGCAGGAGCCTGG - Exonic
916426961 1:164689855-164689877 CTGAAAAAGCTCAAGGGGAGGGG - Intronic
917062702 1:171057491-171057513 CTGGAATACCTGAAGGAGATGGG + Intronic
917481945 1:175419826-175419848 CTGCAAAGGCTGAGGGAGAAAGG - Intronic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921938238 1:220814429-220814451 CTGTGAAAGCTGACTGAGGCTGG + Exonic
923701835 1:236307149-236307171 TTGAAAAATCTGAAGGAGCCAGG + Intergenic
1062991213 10:1820991-1821013 CACTAAAAGCTGGAAGAGACAGG + Intergenic
1063908265 10:10802822-10802844 GTCTGAAAGCTGAAGGAGAAAGG - Intergenic
1066415502 10:35217589-35217611 CTGTGACAGCTGGAGGACACAGG + Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1069028614 10:63571399-63571421 CTGTAGAAGCTGGAGTAGACAGG - Intronic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1072250163 10:93575614-93575636 CTGTGTAAGCTGAAGGACACAGG - Intronic
1072715438 10:97749417-97749439 TCGTAACAGCAGAAGGAGACGGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073860843 10:107737290-107737312 CTGGAAAAGTTGAAGAGGACTGG - Intergenic
1073919843 10:108446126-108446148 CAGTAAAAACTGAAAGAGTCAGG - Intergenic
1074661310 10:115660912-115660934 GTTTAAATGCTGATGGAGACAGG + Intronic
1074935247 10:118172138-118172160 CTGGAAAAACTGCAGAAGACTGG + Intergenic
1075484762 10:122813100-122813122 CTCTACAAGATGCAGGAGACAGG - Intergenic
1076128005 10:127991555-127991577 TTTTGAAAGCTGAATGAGACAGG - Intronic
1076501759 10:130942726-130942748 CTGGAAGAGCTGCAGGAGACCGG + Intergenic
1079583763 11:22098971-22098993 CTGTAAAAGCTAAAGCAGCATGG + Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087593218 11:100219199-100219221 CTGTCAAAGCTGAATTAGACAGG + Intronic
1088224441 11:107604019-107604041 CGTTAGAAGCTGAATGAGACAGG + Intronic
1088583159 11:111334652-111334674 CTGTGAAAGATGCAGGAGCCTGG + Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1088938462 11:114428459-114428481 CTGTAAAAGTTCAGTGAGACAGG - Intronic
1089331983 11:117696075-117696097 CGGTGAAAGCTGAAGGAAAAGGG + Intronic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1093264551 12:16987355-16987377 CAGGAAAAGCTGATGGAGACAGG - Intergenic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1096267442 12:50135072-50135094 ATGTAAAAGTGAAAGGAGACAGG + Intronic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1096686223 12:53290044-53290066 CTTTAACAGCTGAATGAGTCTGG + Intronic
1097606462 12:61760637-61760659 CTTTAAAAGGTTAATGAGACGGG + Intronic
1097626620 12:62010044-62010066 ATGTAAAAGCTAATGGAGAATGG - Intronic
1098291557 12:68961616-68961638 CTGTATAAGTTGAATGAGCCAGG + Intronic
1099117500 12:78646087-78646109 CAATAAAAGCTGAATGACACAGG - Intergenic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1102203466 12:111074541-111074563 CTGTCCAAGCTGAAGGCCACAGG - Intronic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1103374511 12:120445433-120445455 GTGTAAGACCTGAGGGAGACTGG + Intronic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1105289280 13:19038031-19038053 CTTGAAAAACTGAAGAAGACGGG + Intergenic
1106423736 13:29605956-29605978 CTGTCAGAGCTGAAAGAGACAGG + Intergenic
1107365513 13:39668923-39668945 CTGCAAAATCTGAATAAGACAGG - Intronic
1108105822 13:47007850-47007872 AATTAAAAGCTGAAGGAGCCAGG + Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108870091 13:54974251-54974273 GTGTAAAAGTTGAAAGAGGCCGG - Intergenic
1108961932 13:56244991-56245013 CTGTAAAGACTGACAGAGACTGG - Intergenic
1109099014 13:58155873-58155895 CTCTAAACACTGAAGGAGATTGG + Intergenic
1109504437 13:63281686-63281708 CAGTAAAAATTGAAGCAGACAGG + Intergenic
1109798285 13:67343899-67343921 CTATAGAAGCTGTAGGAAACAGG - Intergenic
1110690786 13:78428180-78428202 CTATAGAAGCTGTAGGAAACAGG - Intergenic
1111767391 13:92548936-92548958 CTATAAATACTGAAGGTGACAGG + Intronic
1111961635 13:94816912-94816934 TTTTAAAAGCTGAAGGAGAAAGG - Intergenic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1112678468 13:101732951-101732973 CTGTAAAAGATGAAAGAGATTGG - Intronic
1112904927 13:104405579-104405601 ATGCAAAAGCTGAGGGAGATGGG + Intergenic
1113211850 13:107992888-107992910 CTGTAAAAACTGTCTGAGACTGG + Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114933939 14:27509268-27509290 CTGTGAAAAATAAAGGAGACAGG - Intergenic
1117512237 14:56464452-56464474 ATGTAAAAGTTGAATCAGACTGG - Intergenic
1117634893 14:57731458-57731480 CTGTGGAAGCTAAAGCAGACTGG + Intronic
1117702982 14:58433717-58433739 TTATAAAAGCTGAAGGAAGCTGG + Intronic
1118530838 14:66703172-66703194 CTGGAATACCTGAAGGAGATGGG + Intronic
1120678003 14:87444088-87444110 CATGAAAAGCTGAAGCAGACTGG + Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120887632 14:89464141-89464163 CTGAGAAATCTGGAGGAGACTGG - Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1124874762 15:33581413-33581435 CTTTAAAAGGTGAATGATACAGG + Intronic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127918006 15:63471359-63471381 ATCCAAATGCTGAAGGAGACTGG + Intergenic
1128924940 15:71646743-71646765 CTGTCAAAGCATAAGGACACTGG + Intronic
1129555910 15:76509258-76509280 GTGTGAAAGCTGAAGAAGAGGGG - Intronic
1130049511 15:80472036-80472058 CTGCAAAAGCTCTTGGAGACAGG - Intronic
1131925928 15:97383672-97383694 CTGTAATAGCTAAAGGGGAGTGG - Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1137930025 16:52578239-52578261 TTGGAAAAGCTGAAAGAGAGGGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1142984554 17:3688097-3688119 CTGGCAAATCTGAGGGAGACAGG + Exonic
1143368063 17:6421284-6421306 CTCTAAAAGCTGAAATAGGCAGG + Intronic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144138591 17:12322946-12322968 CTGTAAAATCTGAAAATGACTGG + Intergenic
1145846183 17:28041355-28041377 CTGCAAAAGCTGGAAGAGAGGGG - Intergenic
1148287763 17:46410900-46410922 CTGTAAAAGCTGGAGAACCCTGG - Intergenic
1148309932 17:46628480-46628502 CTGTAAAAGCTGGAGAACCCTGG - Intronic
1152156172 17:78634410-78634432 GTGTAAATGCTGAAGAAGAAGGG + Intergenic
1153151075 18:2094002-2094024 CTGAAAAATTTGAATGAGACTGG + Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1155340339 18:24807478-24807500 CTGAAAGAGCTGCAGGACACAGG + Intergenic
1155839356 18:30627836-30627858 ATGAAAAAGCTGAAGGAAATAGG - Intergenic
1158247588 18:55449459-55449481 CTGAAAGTTCTGAAGGAGACAGG + Intronic
1158491760 18:57916442-57916464 CTCTCAAAGCTGAGGGAGGCAGG + Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1159471051 18:68856631-68856653 CTGTATTAGCTGAAGGACTCAGG + Intronic
1160100813 18:75917589-75917611 ACGTAAATGCTGAAGGAAACAGG + Intergenic
1160206660 18:76840192-76840214 CTTTAAAAAATGAGGGAGACCGG + Intronic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1167259067 19:48447675-48447697 TTCTAAAAACTGAAGGAGGCCGG - Intronic
925594645 2:5543293-5543315 TTCAAAAAGCGGAAGGAGACAGG - Intergenic
925962261 2:9028593-9028615 CTCTAAAAGTTGAACGAGGCCGG - Intergenic
927586425 2:24310508-24310530 GGGTAAAGGCTGAATGAGACTGG + Exonic
931892203 2:66685746-66685768 CTTTAAAATCTTAAGGAAACTGG - Intergenic
933129645 2:78656346-78656368 CTGGAGCACCTGAAGGAGACAGG + Intergenic
936074191 2:109391293-109391315 CTGTAATGGCTGAAGCATACAGG - Intronic
938923729 2:136019635-136019657 ATGTTAAGACTGAAGGAGACAGG + Intergenic
939052029 2:137318742-137318764 TTGGAAAAGCTGAAGGACAAAGG - Intronic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939632830 2:144546027-144546049 CCGTAAACTCTGCAGGAGACAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942695909 2:178645177-178645199 CTTTAAAAGCTGAAATAAACTGG - Intronic
943280062 2:185920981-185921003 CTGAAAAAGCTGAAAGATAGAGG - Intergenic
943795333 2:191985999-191986021 CTTTCATAGCTCAAGGAGACGGG - Intronic
945553111 2:211246064-211246086 CAGTAAGAGATGAATGAGACAGG - Intergenic
946110921 2:217416060-217416082 TTGTAAAAGCTGAAGAAATCAGG + Intronic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947809165 2:232989566-232989588 TTCTAAAAACTAAAGGAGACAGG + Intronic
948882950 2:240869590-240869612 CAGAAACAGCTCAAGGAGACTGG - Intronic
1169724422 20:8713794-8713816 CTGTTAATGCTGCAGGTGACAGG - Intronic
1170559058 20:17540352-17540374 GTGTCAAAGCTGAGGGTGACAGG - Intronic
1171057513 20:21921486-21921508 CCGTCAAAGCTTAAGGAGAACGG + Intergenic
1172293317 20:33791269-33791291 CTGGAGGAGCTGAAGGACACAGG + Exonic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1173404570 20:42753535-42753557 CTGTTCAATGTGAAGGAGACTGG + Intronic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1176235665 20:64052413-64052435 CTGTCCAAGCTGAGGGAGAGGGG - Intronic
1177709233 21:24749884-24749906 CTTTAAGAGCTGAAGGATAAAGG - Intergenic
1179261201 21:39759568-39759590 CTGAAAAAGCTGAGGCAGGCTGG + Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1182188649 22:28435519-28435541 CTGTAGAAGCTAAAGCTGACAGG + Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1183888943 22:40909308-40909330 TTGTGAAAGCTGAAGGTGAGAGG - Intronic
1184463633 22:44656000-44656022 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
1185106940 22:48877091-48877113 TTGTAAAATCTGAACCAGACAGG - Intergenic
949266261 3:2160096-2160118 ATGGAAAAGCTAAAGTAGACTGG + Intronic
949592857 3:5511728-5511750 TTGGAATACCTGAAGGAGACAGG + Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
952658284 3:35814244-35814266 ATATAAAAACTGAAGGAGAGAGG + Intergenic
952742977 3:36752051-36752073 GTGTAAGAGCTGGAGGAGAGGGG - Intergenic
953811256 3:46114771-46114793 CTATAGAAGCTGCAGGAAACAGG - Intergenic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
956814597 3:72896546-72896568 CATTAAAAGCTGAAGGAGTGTGG + Intronic
957253035 3:77798902-77798924 CTGTACAAGCTGCAGAGGACAGG + Intergenic
958797251 3:98718715-98718737 CTTTAGAAGCTGAAGAAGGCAGG + Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960363542 3:116743541-116743563 CTCTAAAAGTTGAAGAAGAATGG + Intronic
961121060 3:124370549-124370571 CTGTCAAAGCAAAAGCAGACTGG - Intronic
962150830 3:132891698-132891720 CTGTAAAAGCTGGAAAAGAGAGG + Intergenic
963410717 3:144923737-144923759 CTGTGAGAGCTGAAGAACACAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964525941 3:157615412-157615434 GTGGAAAAGCTGAAAGAGAGAGG - Intronic
965656145 3:170987397-170987419 CTGTAAGAAATGCAGGAGACAGG + Intergenic
966128137 3:176604349-176604371 ATGTGAAAGTTGAAGGACACAGG + Intergenic
967595444 3:191322615-191322637 CTATAATAGCTGAAGGGGACTGG + Intronic
967741726 3:193010441-193010463 CTGTCAAGGCTGAAGGGGACAGG + Intergenic
967761171 3:193228046-193228068 CTGTAAATACTGATAGAGACAGG + Intergenic
968149662 3:196327242-196327264 CTGTAGAAGCTCTAAGAGACAGG - Intronic
969890618 4:10256636-10256658 CTATTAAACCTGAAGGAGCCAGG + Intergenic
970020974 4:11568219-11568241 CTGTAAAAACTGCTTGAGACTGG + Intergenic
973070581 4:45853390-45853412 CTGGAAAACCTGGAGGAGATGGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
977025343 4:91811773-91811795 CTGTCTAAGCTGAAAGAAACAGG + Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980938904 4:139253741-139253763 CATTAAAAGCTGAAGAAGCCAGG - Intergenic
981300290 4:143179050-143179072 CTATAGAAGCTGTAGGAAACAGG - Intergenic
981342380 4:143636365-143636387 ATGGTCAAGCTGAAGGAGACAGG + Intronic
983452126 4:167923856-167923878 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
985174253 4:187184752-187184774 CTGTAAAAGCTGCTGATGACTGG - Intergenic
986415529 5:7524543-7524565 CTGTAGAAGATCAAAGAGACTGG - Intronic
986452491 5:7880580-7880602 CTTAAAAAGCTGGAGGACACAGG - Intronic
987454064 5:18121171-18121193 CTCTATAAGCTGGAGGAGATTGG + Intergenic
988695302 5:33615856-33615878 CTGGAAAAGCTGATGGCCACAGG - Exonic
988797940 5:34669243-34669265 CTCTAAAAGCCTAATGAGACAGG + Intronic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
994780835 5:104088017-104088039 CTCTAGAAGCTGAAAGGGACAGG - Intergenic
996655038 5:125925422-125925444 CTATAGAAGCTGTAGGAAACAGG + Intergenic
997064472 5:130545419-130545441 CTGTAGAAGCTATAGGAAACAGG - Intergenic
997404406 5:133633433-133633455 ATGTAAAAGCTGAAAGATACAGG - Intergenic
997635954 5:135405916-135405938 CTGGCAAAGCTGTAGGAAACAGG + Intergenic
998084643 5:139309178-139309200 CTGAAAAAGTTGAAAGAGAAAGG - Intronic
999806802 5:155088961-155088983 TGATAAAAGCTGAAAGAGACTGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003222349 6:4172287-4172309 TTGTAAAAGATGCAGCAGACAGG - Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1004651728 6:17616531-17616553 CTGTAAATGCTGCTGGAGACTGG + Exonic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1005947754 6:30606688-30606710 CTGTCAGAGGTGAAGCAGACTGG + Intronic
1006016580 6:31086047-31086069 CTTTAAAAGCTGAGAGAAACGGG + Intergenic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008614591 6:53214081-53214103 CTGGTAAAGGTAAAGGAGACTGG + Intergenic
1010516140 6:76774041-76774063 GTGTAAAAGCTTAAGGCCACTGG - Intergenic
1011153093 6:84297373-84297395 CTGGAGAAGCTGAAGTAGTCTGG + Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011636491 6:89379456-89379478 CTGTAAATTCTGAAGGGGGCTGG - Intronic
1012347671 6:98211383-98211405 CTGTAAAACTTGAAGAAAACAGG + Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013533537 6:111041958-111041980 TTGTAAAGGCTAAAGGAGAGGGG + Intergenic
1013632986 6:112002807-112002829 CAGTGAAAGCTGGAGGAGTCAGG - Intergenic
1013919600 6:115387440-115387462 ATGCAAAAGCTGAAAGAGCCTGG + Intergenic
1014756324 6:125305174-125305196 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
1014827060 6:126058575-126058597 GTGTAAGAACTGAAGGAGATAGG + Intergenic
1015938492 6:138425787-138425809 CTGGAAGAGCTGAGGAAGACTGG - Intronic
1016454604 6:144217357-144217379 CGGAAGAAGCCGAAGGAGACAGG - Intergenic
1018141041 6:160837585-160837607 CTGAAAAATCTTCAGGAGACTGG - Intergenic
1019152410 6:170017534-170017556 CTGTAAAAGCTGTTGGTGAGAGG + Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1022513513 7:30959700-30959722 CTGTCAAAGCAAAAGCAGACCGG + Intronic
1022634803 7:32121255-32121277 TTGGAATACCTGAAGGAGACAGG + Intronic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1029542980 7:101195509-101195531 CTGTTAAAGCTGTAGTAGGCTGG - Exonic
1031791720 7:126114876-126114898 CTGTCAATGCTGAGGGAGAAAGG - Intergenic
1032510792 7:132470799-132470821 CTTTAGAAGCTGAAAAAGACAGG + Intronic
1032745164 7:134779059-134779081 TTCTAAAACCTGAAGGAGACAGG - Intronic
1032907131 7:136381297-136381319 CTGTAAAAGTTGAAGATTACTGG + Intergenic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1033894595 7:146055050-146055072 CTATAAAAGCTCTAGGAAACAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035839019 8:2790084-2790106 CTTTAAAGGCAGAATGAGACTGG + Intergenic
1036048762 8:5172728-5172750 CACCATAAGCTGAAGGAGACTGG + Intergenic
1036288380 8:7464304-7464326 CTTAAAAAGATGAAGGAGAAGGG - Intergenic
1036333095 8:7847224-7847246 CTTAAAAAGATGAAGGAGAAGGG + Intergenic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1042188228 8:66158028-66158050 CTGTAGAAGCCCAAGGAAACTGG - Intronic
1044148697 8:88746844-88746866 CTGTTAAGGGTGAAGGAGAAGGG + Intergenic
1044618189 8:94163532-94163554 CCCTAAAACCTGAAGGAGCCAGG - Intronic
1044770937 8:95633249-95633271 CTGTACATTGTGAAGGAGACAGG - Intergenic
1045197265 8:99944670-99944692 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
1046510187 8:115192318-115192340 CTTTTAAAGATGAAGAAGACAGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051930140 9:22375242-22375264 GTGGAATAGCTGAAGGAAACTGG - Intergenic
1053057313 9:35001178-35001200 CTTTAAGAGCCGAAGAAGACAGG - Intergenic
1053861223 9:42388092-42388114 CTGTAAATGCTTATGAAGACTGG - Intergenic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1056495738 9:87153291-87153313 CTTTAAAAACTGAATCAGACTGG - Intronic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1057755604 9:97832457-97832479 TTGTAAAAACTAAATGAGACAGG + Intergenic
1058664235 9:107295348-107295370 CTGAAAAAGCTGGGGGAGATAGG + Intronic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059084847 9:111289013-111289035 GTATAAAAGCTGAAGGAAATAGG - Intergenic
1059127884 9:111711200-111711222 CTGTAAATGGTGATAGAGACAGG + Intronic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1185529623 X:807079-807101 TTGTAAAAGTTAAAGGAAACGGG + Intergenic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1192948480 X:75990739-75990761 GTGAAAAAGCTGAAGGGGGCAGG + Intergenic
1194024262 X:88732187-88732209 TTGTAAAACCTCAAGGAGAAGGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194902861 X:99535915-99535937 CTGAAAGAGCTTAAGGAAACTGG + Intergenic
1194993783 X:100571889-100571911 CTATAGAAGCTGTAGGAAACAGG - Intergenic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196631644 X:117947643-117947665 CTTCAAAAGCTGAAGAAGCCTGG + Intronic
1197357894 X:125459202-125459224 CTGTAAGAGCTAAATGAGAGGGG + Intergenic
1197883731 X:131195983-131196005 CTGTAGAAGGTGTAGGAAACTGG + Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1199533180 X:148872309-148872331 CTGTAGAGACTGAAAGAGACTGG - Intronic
1199807048 X:151310384-151310406 CTGCAAAAGCTAATGCAGACAGG + Intergenic