ID: 1121397970

View in Genome Browser
Species Human (GRCh38)
Location 14:93643795-93643817
Sequence CACAAATACCAGTATCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121397970 Original CRISPR CACAAATACCAGTATCTACA AGG (reversed) Intronic
902716272 1:18275164-18275186 CACAAAGACCTGTGCCTACAAGG - Intronic
903910198 1:26718534-26718556 CACAAATTTCAGTATCCTCAGGG - Intronic
904105976 1:28084365-28084387 AAAAGATACCAGTATCAACAGGG + Intronic
909337216 1:74489403-74489425 CAGAATTAGCTGTATCTACAGGG + Intronic
915041080 1:152968839-152968861 CACACATACCAGTGCCTTCAAGG + Intergenic
915200604 1:154225091-154225113 TACAAATAACAGTATTTACAAGG - Exonic
915491229 1:156251049-156251071 CCCAAACACCAGGATCTCCAGGG + Intronic
918696572 1:187552847-187552869 CACAAATATGAGTATCTTCCTGG - Intergenic
920980077 1:210825776-210825798 TACAGATACCAGTAACTTCAGGG + Intronic
921303229 1:213770308-213770330 GACAAGTTCCAGTATCTACAGGG - Intergenic
922409998 1:225363656-225363678 CAAGAATTCCAGTATCCACAGGG - Intronic
1063217032 10:3933865-3933887 CTGAAATGCCATTATCTACAGGG - Intergenic
1065100193 10:22324131-22324153 CACAAAGACAAGTATTAACAAGG - Intronic
1066079482 10:31916192-31916214 CCCAACTCCCAGTATATACAAGG + Intronic
1068294406 10:55051014-55051036 CACAATTAGCAGTAGTTACATGG - Intronic
1070070652 10:73086024-73086046 CACAATTACAAGTATTGACAAGG + Intronic
1070476457 10:76834055-76834077 CACACACAGCAGTATGTACAAGG + Intergenic
1071314507 10:84381100-84381122 CACAACAACCAGTATCACCAGGG - Intronic
1074674884 10:115836838-115836860 CACAAATACAGGTATCAACTGGG - Intronic
1076632942 10:131862835-131862857 CCCAAAAAACAGTATATACAGGG - Intergenic
1079138445 11:17790630-17790652 TACAAATACCAGTTTGTACAAGG - Intronic
1080727651 11:34914502-34914524 GACAAATACAAATATCTAGAGGG + Intronic
1084852831 11:71957135-71957157 CACATTTATCAGTATCTTCAAGG - Intronic
1085975897 11:81654394-81654416 GACTAATACCAGAATCTATAAGG - Intergenic
1089897754 11:121948940-121948962 CACAAACACCAGAATCAATATGG - Intergenic
1093329722 12:17820737-17820759 AAAAAATACCAGTATCTATCTGG - Intergenic
1093355328 12:18159844-18159866 CAAAAATACCTGAATCTTCATGG + Intronic
1096013079 12:48238841-48238863 CAAAAATACCAATATCTTAAGGG + Intergenic
1096131235 12:49160504-49160526 CACAAAAGCCAGGAGCTACACGG - Intergenic
1099588490 12:84553822-84553844 CTCAAATACAAGTATTTGCATGG + Intergenic
1100429034 12:94514016-94514038 CAAAAATACTAATATTTACAGGG + Intergenic
1101583013 12:106060561-106060583 CAGAAAGAACAGTATCTGCAAGG - Intergenic
1102996828 12:117357966-117357988 CACAAATTCCAGTTTCTAATGGG + Intronic
1104012531 12:124941978-124942000 CACAAAAACCTGCATCTGCATGG - Intergenic
1104866564 12:131959421-131959443 TACAGACTCCAGTATCTACAGGG - Intronic
1107380804 13:39855020-39855042 GAAAAATAGCAGTGTCTACATGG - Intergenic
1109830190 13:67775974-67775996 CACAAATATCTGTAGCAACAAGG + Intergenic
1111495996 13:89051628-89051650 TACAAACTCCAGTGTCTACAAGG - Intergenic
1112196929 13:97235495-97235517 CAAGAATTCCGGTATCTACAAGG - Intronic
1114760334 14:25307492-25307514 CACAAATACAAGTAGCCATAGGG + Intergenic
1118281155 14:64429923-64429945 AACAAATGCCAGTAATTACAAGG + Intronic
1120320396 14:82952134-82952156 TAGAAATCTCAGTATCTACAGGG - Intergenic
1121185939 14:91969371-91969393 CAAAAATACTAGTAGCTATATGG - Exonic
1121397970 14:93643795-93643817 CACAAATACCAGTATCTACAAGG - Intronic
1122105345 14:99449252-99449274 TACAAAAACCAGTATCTATCAGG + Intronic
1126311708 15:47324969-47324991 ATCAAATACCAATATATACATGG - Intronic
1126767938 15:52027557-52027579 CACAAATGGCACAATCTACATGG - Intronic
1130620631 15:85458579-85458601 TACAAATAACTGTGTCTACAAGG - Intronic
1135899989 16:26448549-26448571 CACAAATGCCATGAGCTACATGG - Intergenic
1137374590 16:47941771-47941793 CACAAGTACCAGAATTTTCAAGG - Intergenic
1138068465 16:53966434-53966456 CTCAAATACCAAAATCAACAAGG + Intronic
1141058576 16:80842447-80842469 CACAAAAACAAGAATCTATATGG - Intergenic
1141310898 16:82912366-82912388 CACAATAACCAGTAACTCCATGG + Intronic
1141761034 16:86028890-86028912 CACAAATACCTGCACCTCCAAGG - Intergenic
1142722909 17:1788989-1789011 AAAAAATACCAGTATTTAAAAGG + Intronic
1143310738 17:5986684-5986706 GACTAATACCAGAATCTATAAGG + Intronic
1150103790 17:62446853-62446875 CCCCTATACCAGTATCTGCAGGG + Intronic
1155593687 18:27457329-27457351 GAAAATTACCAGTATCAACAAGG - Intergenic
1158079839 18:53576856-53576878 CACAGATACCAGAGTCAACATGG + Intergenic
1158187532 18:54787940-54787962 CAGAAATATCTGAATCTACATGG + Intronic
1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG + Intergenic
1161685114 19:5698681-5698703 CACATAGACCAGCATCTGCACGG + Intronic
1162659698 19:12159411-12159433 CTGAAATACCAGTATCCCCAGGG + Intergenic
1164029669 19:21391902-21391924 GACAAATGAAAGTATCTACAGGG - Intergenic
1164289424 19:23853929-23853951 CATCAATCCCAGTATCTACTAGG + Intergenic
1165670206 19:37671922-37671944 CACAAATACCAGGAACAAAAAGG + Intronic
926075902 2:9942466-9942488 CACAGATGCCAGTACCCACAGGG + Intergenic
926345560 2:11941870-11941892 CACAAAAACCACGAGCTACATGG - Intergenic
928705652 2:33946947-33946969 CTCATCTACCAGCATCTACATGG + Intergenic
930313274 2:49769227-49769249 CACAATTACAAGTATCCAGAAGG - Intergenic
931978968 2:67674146-67674168 CAAAAACTCAAGTATCTACAGGG - Intergenic
933337490 2:80976900-80976922 CATAAATACCAGTATGAACATGG + Intergenic
933762377 2:85681197-85681219 AAGAAATACCATTATCAACAAGG - Intergenic
933832373 2:86221500-86221522 CACAAAGACCAGTGACTCCAGGG + Intronic
936935864 2:117837533-117837555 TAAAAATACTTGTATCTACAAGG - Intergenic
937331218 2:121031558-121031580 GACAAATACCAGCACTTACACGG - Intergenic
937946745 2:127345631-127345653 AACAAATCTCAGTAACTACATGG + Intronic
939401466 2:141700244-141700266 AACAAATACCAGCTTTTACATGG - Intronic
943176344 2:184479346-184479368 CACTAATACTTGTATCAACATGG - Intergenic
944115890 2:196185656-196185678 CCCCAATTCCAGTATCTCCATGG + Intergenic
944457281 2:199908618-199908640 CACAAACTCCAATATCTACAGGG - Intergenic
945171095 2:206995867-206995889 CACACATACAAATAGCTACAGGG + Intergenic
945180400 2:207085594-207085616 CACAAAACCCAGTGTCTGCAAGG + Intronic
946549330 2:220783278-220783300 GACAAATTCTAGTTTCTACAGGG + Intergenic
947966143 2:234283030-234283052 CACAAATGCCAGGACCTTCAGGG + Intergenic
1168777532 20:460954-460976 CACAAACACCAGTAATTAAAGGG + Intronic
1169495854 20:6114262-6114284 CAGAAACACCTGTATCTTCAAGG + Intronic
1170007435 20:11684609-11684631 CACAAATACCAGGAGCTTTAAGG - Intergenic
1172287998 20:33754701-33754723 CTCAAATACCCTCATCTACATGG - Intronic
1173829810 20:46075033-46075055 CACAAATATCATCATCTAAATGG + Intronic
1178182944 21:30185120-30185142 CACAAATCCCAAAATATACAAGG + Intergenic
1185022112 22:48382712-48382734 CAAAAATACCAGTATCTTCAAGG + Intergenic
1185029743 22:48435715-48435737 CACACACACAAGTATGTACATGG + Intergenic
950813870 3:15677871-15677893 GAAAAATAACAGTATCTACTTGG - Intronic
954683110 3:52356477-52356499 CACCAAAGCCAGTGTCTACAGGG - Intronic
956507332 3:69956155-69956177 CCCTAATAACAGTATCTCCAAGG + Intronic
957841517 3:85676732-85676754 TACAAAAAGCAGTATTTACATGG - Intronic
959242169 3:103809836-103809858 CACAAATATCAGATTCTCCAAGG + Intergenic
959846094 3:111035664-111035686 GACATATCCCAGTATCTACCTGG + Intergenic
960766139 3:121132447-121132469 CACAGATGCCTGTATCTCCATGG + Intronic
963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG + Intronic
965557888 3:170036572-170036594 CACAAAATCCAGGAGCTACATGG - Intergenic
965584058 3:170299546-170299568 TACAAATACCAGTAACTGAATGG - Intronic
965730530 3:171767451-171767473 CACAGATGTCAGTATCTACATGG + Intronic
966436949 3:179897586-179897608 CACAAATGCCATTTTCTGCATGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
969499794 4:7545705-7545727 CACAAACACCAGGCTCTCCAGGG - Intronic
970746838 4:19308498-19308520 CTCTAATACCATTACCTACAAGG + Intergenic
971232809 4:24813921-24813943 AACAAACATCAGTATCAACAGGG + Intronic
971610075 4:28712536-28712558 CACATATAACACTTTCTACAGGG - Intergenic
971895146 4:32582726-32582748 CACAAATAACATTATATACGTGG - Intergenic
972067024 4:34960574-34960596 CTTAAATACCATTATTTACATGG + Intergenic
972631744 4:40848126-40848148 CAGAAATACTTGTATCTAGATGG - Intronic
973765953 4:54163014-54163036 AACAAATACCAGTAGCTACTTGG - Intronic
974750336 4:66131828-66131850 TACAAATACCAGTCGCAACATGG - Intergenic
975974887 4:80083766-80083788 CACAAAAACCTGTATATAAATGG + Intronic
978127764 4:105154898-105154920 CACAAGTACCTGGAACTACAGGG - Intronic
979267926 4:118725180-118725202 CACACATATCTGTATCCACATGG - Intronic
979740006 4:124137753-124137775 CAAATACACCAGAATCTACAAGG + Intergenic
980271702 4:130592486-130592508 GACAAAGGCCAGAATCTACAGGG - Intergenic
980497254 4:133602477-133602499 CTCTAATATCAGTATTTACAAGG - Intergenic
981126579 4:141113973-141113995 CACAAGTATCAGAATCTCCAGGG + Intronic
981306995 4:143256905-143256927 CACAAATACATGTTTCTATATGG + Intergenic
981877332 4:149563131-149563153 CACATATACAAATATCTACCTGG - Intergenic
982152358 4:152474301-152474323 TAAAACTACCAGTATTTACATGG - Intronic
987439632 5:17940405-17940427 CACAGTTACAAGTATCTAAAGGG + Intergenic
987659920 5:20859062-20859084 CACAAATGCCATTTTTTACATGG - Intergenic
988763725 5:34346590-34346612 CACAAATGCCATTTTTTACATGG + Intergenic
989236913 5:39158671-39158693 CACAAACATTAGAATCTACAAGG - Intronic
993785369 5:92126657-92126679 GAGAAATACCAGTATCTAGTTGG + Intergenic
994767295 5:103934991-103935013 CGCAAATACCATTTTATACAAGG - Intergenic
998663567 5:144268447-144268469 CACAAATAACTTTATATACAGGG + Intronic
1000408509 5:160914388-160914410 CACAGATTTTAGTATCTACAGGG - Intergenic
1000870386 5:166569916-166569938 AGCAAATACCAGAAGCTACAGGG - Intergenic
1000961573 5:167607051-167607073 CACAAATTTAAATATCTACAGGG + Intronic
1001025838 5:168223890-168223912 AAAAAATATCAGTATCTATATGG - Intronic
1003995107 6:11532360-11532382 GACAAATCCCAGGATCTGCAGGG - Intergenic
1005242409 6:23846554-23846576 TATAATAACCAGTATCTACAAGG - Intergenic
1010595828 6:77763001-77763023 TATAAATGCCAGTATCTTCAAGG - Intronic
1010976320 6:82318368-82318390 GACTAATATCAGAATCTACAAGG + Intergenic
1013919131 6:115379704-115379726 CAAAAATATCAGTATTTACCTGG + Intergenic
1014299212 6:119659572-119659594 CACAAATTCAAATATCTACAAGG - Intergenic
1016221762 6:141681363-141681385 CACAAATAACAGCATCAAAATGG + Intergenic
1016290380 6:142522517-142522539 CACAGATAACTGTATCTAAAAGG + Intergenic
1017392337 6:153954890-153954912 GGCTAATACCAGAATCTACAAGG - Intergenic
1018280261 6:162178357-162178379 CACAAACACCAGTGTCTTAAGGG - Intronic
1019108238 6:169687443-169687465 CACAAAAAACAATATCTAAATGG + Intronic
1020444529 7:8255443-8255465 CTCAAATATCAGTATCTGTAAGG + Intronic
1021514975 7:21474315-21474337 CAAAAATACCTGTGTCTTCAGGG + Intronic
1023369828 7:39502213-39502235 CCCAAATAACAGAATCCACAGGG + Intergenic
1025923169 7:65933758-65933780 AAAAAATACCAATATCTAAAAGG - Intronic
1026934248 7:74243474-74243496 CACGAAAACCACGATCTACAAGG + Intronic
1030663073 7:112243441-112243463 GACTAATACCAGAATCCACAAGG + Intronic
1032032978 7:128500059-128500081 CCCGTATACCAGTATCTGCAGGG + Intronic
1032402092 7:131630581-131630603 CATAGATACCAGTATCTGCCAGG - Intergenic
1033309876 7:140253395-140253417 CACAAATCTCATTATCTGCAGGG - Intergenic
1033363607 7:140655173-140655195 CACCACTACCACTATCTACAAGG + Intronic
1042337427 8:67643211-67643233 CACAACTACCAGTTTCTCAATGG + Intronic
1042965462 8:74347140-74347162 CACAATTACCATTATATCCAGGG - Intronic
1046209232 8:111045392-111045414 CACTAACACCAGAATCTAAATGG + Intergenic
1046328052 8:112675665-112675687 TACAAATTTCAGTATCTGCATGG + Intronic
1046677909 8:117132559-117132581 CACTAAAACCAATGTCTACAGGG + Intronic
1048725349 8:137376873-137376895 GACAAATTCCAAGATCTACAGGG - Intergenic
1049387474 8:142350673-142350695 CACAAACACCACCATCTACAGGG + Intronic
1051895875 9:21988790-21988812 TAAAAATACCACTATGTACAAGG + Intronic
1052629041 9:31013394-31013416 CATAATTTCCAGCATCTACAAGG + Intergenic
1055264529 9:74479576-74479598 CACAAAACCCAGAATCTAAAAGG + Intergenic
1055470909 9:76609397-76609419 CACAAATACAGGAAACTACATGG - Intergenic
1056507334 9:87269536-87269558 CACAAACATCAGTGTCCACAGGG + Intergenic
1056937745 9:90930138-90930160 AACAAATACTTGTATCTACTTGG - Intergenic
1057011015 9:91601259-91601281 CATAAATAACAGTATCCTCACGG - Intronic
1057572017 9:96211666-96211688 CTCAAATCCCACTATCTCCATGG + Intergenic
1058928691 9:109696610-109696632 TACAAAGACATGTATCTACAAGG + Intronic
1061771720 9:132929497-132929519 CCCAAATACCACTGGCTACAGGG + Intronic
1185668788 X:1788916-1788938 CACCAATACCAATATATACGAGG - Intergenic
1188584866 X:31761350-31761372 CACAAACCCCAATATTTACATGG - Intronic
1192612352 X:72579806-72579828 CACAGATACCATGATATACAGGG + Exonic
1193371343 X:80700919-80700941 TGCAAATAACAGAATCTACAAGG - Intronic
1193454292 X:81711125-81711147 TAAAAATAACAGTATCTATAAGG - Intergenic
1194604005 X:95958706-95958728 GACTAATACCAGTATGTAGATGG + Intergenic
1195514589 X:105758917-105758939 CACAAAAACCAGCAGCTGCATGG - Intronic
1196184372 X:112730050-112730072 CAATAATAGCAATATCTACACGG + Intergenic
1197312708 X:124925783-124925805 CACAAATTCAAATATTTACATGG + Intronic
1197364978 X:125553055-125553077 CACAACCACCAGTAAGTACATGG + Intergenic
1197604320 X:128566393-128566415 AACAAATACCTTTATGTACAGGG - Intergenic