ID: 1121398657

View in Genome Browser
Species Human (GRCh38)
Location 14:93652080-93652102
Sequence CAGTCTGAGCCATTGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121398657_1121398661 7 Left 1121398657 14:93652080-93652102 CCTTATTGCAATGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 188
Right 1121398661 14:93652110-93652132 AATCATAGAGATGGGAGAGTCGG 0: 1
1: 0
2: 2
3: 17
4: 363
1121398657_1121398659 -1 Left 1121398657 14:93652080-93652102 CCTTATTGCAATGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 188
Right 1121398659 14:93652102-93652124 GCCAGTGTAATCATAGAGATGGG 0: 1
1: 0
2: 0
3: 6
4: 111
1121398657_1121398658 -2 Left 1121398657 14:93652080-93652102 CCTTATTGCAATGGCTCAGACTG 0: 1
1: 0
2: 1
3: 24
4: 188
Right 1121398658 14:93652101-93652123 TGCCAGTGTAATCATAGAGATGG 0: 1
1: 0
2: 0
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121398657 Original CRISPR CAGTCTGAGCCATTGCAATA AGG (reversed) Intronic
900132781 1:1095671-1095693 AAGTCCCAGCCACTGCAATAAGG - Intronic
902101627 1:13995196-13995218 AAGTCTTAGACAGTGCAATAAGG + Intergenic
906455380 1:45992040-45992062 AAGTCTTAGCCAGTGCAATAAGG - Intronic
908379369 1:63581073-63581095 AAGTCTTAGCCAATGCAATAAGG - Intronic
912653639 1:111464966-111464988 GAGTCTGAACCATTACAATCTGG - Intergenic
913031214 1:114904714-114904736 CAGTCTGAGGCCATGCAATAAGG - Intronic
914687887 1:149998071-149998093 CAGTCTGGGTAATAGCAATAAGG - Intronic
914734193 1:150400364-150400386 AAGTTTCAGCCAATGCAATAAGG - Intronic
916768398 1:167883887-167883909 CAATATGAGCCATTGCAATAAGG + Intronic
919243797 1:194951059-194951081 AAGTCTGAGCCAGAGCAATCAGG + Intergenic
919552296 1:199005989-199006011 TAAACTGAGCTATTGCAATAAGG - Intergenic
920282089 1:204851675-204851697 CAGTATGTGCCATTGCTAAATGG + Intronic
924547751 1:245046024-245046046 CAGGCTGAGGCAGGGCAATAGGG - Intronic
1062876999 10:951070-951092 CAGTCCTAGCTATTGCAATAAGG - Intergenic
1067964926 10:50900646-50900668 CAGTCTGAGATATTAAAATATGG - Intergenic
1067990590 10:51207418-51207440 CAGTCAGAGCCAGTGCAGGATGG - Intronic
1069423171 10:68265295-68265317 AGGTCTCAGCCAGTGCAATAAGG + Intergenic
1069465879 10:68638459-68638481 CAATCTGAGACATTACAATTGGG + Intronic
1070977645 10:80618037-80618059 CAGTCTGTGCAGTTCCAATAGGG - Intronic
1071245893 10:83762539-83762561 CAGTCTTAGCCAGTGTAATAAGG + Intergenic
1072156878 10:92731557-92731579 CATTGTGTGCCATTGCCATATGG - Intergenic
1073019875 10:100434180-100434202 AAATCTGATCCATTGCAATTAGG + Intergenic
1075681458 10:124336020-124336042 AAGTCCTAGCCAGTGCAATAAGG + Intergenic
1076197035 10:128526233-128526255 CAGGCAGAGCCATGGCAGTAAGG - Intergenic
1076908421 10:133374883-133374905 CTGTCTGAGCCATTTCATTTTGG - Intergenic
1077541805 11:3150197-3150219 GAGTCTGAGCCAGTACAAAAAGG + Intronic
1078992408 11:16663222-16663244 AGGTCTTAGCCATTACAATATGG + Intronic
1083145771 11:60757409-60757431 CGGTCTGACCCACTGCAATCTGG - Intronic
1083241127 11:61389756-61389778 CAGTCCTGGCCAGTGCAATAAGG + Intergenic
1083545611 11:63546957-63546979 CAGCTTGAGCCATGGCAATCTGG - Intergenic
1084469392 11:69347844-69347866 CAATCCTAGTCATTGCAATAAGG - Intronic
1085543369 11:77293897-77293919 CAGTCCTAGCCAGTGCAATAAGG + Intronic
1086008203 11:82065641-82065663 AAGTCTTAGCCAGTGCAATCAGG - Intergenic
1086504052 11:87484517-87484539 CAGTTTGAGCCTGAGCAATATGG + Intergenic
1087553552 11:99684485-99684507 CAGTTCTAGCCAGTGCAATAAGG - Intronic
1087952782 11:104244310-104244332 CAGTCTTAACTTTTGCAATATGG - Intergenic
1088057723 11:105605737-105605759 TAGTATGAGCCTTTTCAATAAGG - Intergenic
1088114210 11:106297581-106297603 CAGCCTGAGCCACTGCAGGAAGG - Intergenic
1090142969 11:124285063-124285085 AAGTCTGAGCCAAAGCAATCAGG + Intergenic
1090586361 11:128217239-128217261 AAGTTTCAGCCATTACAATAAGG - Intergenic
1091158749 11:133399534-133399556 CAGGCTGTGCCATGGCAATGAGG - Intronic
1091179344 11:133589335-133589357 CAGTGTGAGCCAGTGCATGAGGG - Intergenic
1092561332 12:9616972-9616994 CAGTCTGTGGCATTTCATTATGG + Intergenic
1093299351 12:17435263-17435285 AAGTCTGAGCCAGAGCAATTAGG - Intergenic
1096042819 12:48533878-48533900 AAGTCTGAGCCAGAGCAATCAGG + Intergenic
1096569233 12:52511172-52511194 AGATCTTAGCCATTGCAATAAGG - Intergenic
1096943862 12:55382111-55382133 AAGTCTGAGCCAATGCCATAGGG + Intergenic
1098399611 12:70060057-70060079 AAGTCTGAGCCAGAGCAATCAGG + Intergenic
1100922609 12:99505335-99505357 CAGTTTGAGCCATTGCTAATTGG + Intronic
1102864307 12:116361783-116361805 CAGTCTGAGCCTCTACAAAACGG - Intergenic
1103391573 12:120577862-120577884 CAGTCTCATCCATTGTATTATGG + Intergenic
1103732185 12:123035125-123035147 CAGTCTGAGCCATGCCATTAGGG + Intronic
1104280852 12:127375157-127375179 AAGTCCTAGCCAGTGCAATAAGG + Intergenic
1110629210 13:77686931-77686953 AAGTCTGAGCCAGAGCAATCAGG + Intergenic
1111316397 13:86566865-86566887 CAATCTAAGGCATTTCAATATGG + Intergenic
1111326148 13:86698669-86698691 CAGTCTTAGCTAATCCAATAAGG + Intergenic
1115793012 14:36900830-36900852 CTCTGGGAGCCATTGCAATAGGG + Intronic
1115854297 14:37612985-37613007 AGGTCTTAGCCATTGCAATATGG - Intronic
1118516589 14:66535947-66535969 AAGCCTTGGCCATTGCAATAAGG - Intronic
1119487590 14:75001431-75001453 AAGTCCTAGCCCTTGCAATAAGG - Intergenic
1120794545 14:88618137-88618159 CTGTTAGAGCCATTCCAATAAGG - Exonic
1121398657 14:93652080-93652102 CAGTCTGAGCCATTGCAATAAGG - Intronic
1121475746 14:94200340-94200362 AGCTCTGAGCCAGTGCAATAAGG - Intronic
1122260014 14:100511611-100511633 AGGTTTGAGCCAGTGCAATAAGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124874852 15:33582238-33582260 CAGTATGAGCCTGTGCAAGAAGG + Intronic
1126488433 15:49209334-49209356 AAGTCTGAGCCAGAGCAATCAGG - Intronic
1127403653 15:58617547-58617569 AAGTCTGAGCCAGAGCAATTAGG + Intronic
1129779519 15:78261130-78261152 CAGTCATAACTATTGCAATAGGG + Intergenic
1130857290 15:87851732-87851754 CAGACTGTGCCATTGTAAAATGG - Intergenic
1132411842 15:101585391-101585413 AAGTCCTAGCCATTACAATAAGG - Intergenic
1135157791 16:20068611-20068633 AAGTCCTAGCCAGTGCAATAAGG - Intronic
1137569302 16:49554461-49554483 CAGTCTAAACCATTTCAACAGGG + Intronic
1138047348 16:53739103-53739125 AAGTGTGAGCCATCGCAATCTGG + Intronic
1138771698 16:59672796-59672818 CAGTTTAAGTCATTGCAAGAGGG - Intergenic
1139179677 16:64732015-64732037 CAGTCTGATCAGTTGCAATTTGG + Intergenic
1146953094 17:36920282-36920304 CAGTCTGCGGCATTGCACCAAGG + Intergenic
1148199248 17:45738802-45738824 AAGTTTTAGCCAGTGCAATAAGG - Intergenic
1148802064 17:50234922-50234944 GAGTCCTAGCCAGTGCAATAAGG - Intergenic
1150154471 17:62840381-62840403 AAGTCCTAGCCAGTGCAATAAGG + Intergenic
1150661994 17:67089918-67089940 AAGTCTTAGCCAGTGCAATAAGG - Intronic
1153503960 18:5776248-5776270 CTGTGTAAGCCAGTGCAATACGG + Intergenic
1156856837 18:41791905-41791927 CAGTCTAAGCCATCCCAGTATGG - Intergenic
1157766899 18:50305208-50305230 AAGTCTTAGCCAATGCCATAAGG - Intergenic
1158379208 18:56909930-56909952 CAGGCTGAGCAATTTCAAAAGGG - Intronic
1160082190 18:75738160-75738182 TAGTCTGAGGCAATGCAATGAGG + Intergenic
1163596423 19:18223736-18223758 CAGTTTGTCCCTTTGCAATATGG - Intronic
1163735193 19:18975675-18975697 AAGTGTGAGCCACTGCAACAGGG - Intergenic
1164114611 19:22207081-22207103 CAGTCTTAGCCAGAGCAATCAGG + Intergenic
929812041 2:45198416-45198438 CAGTCCTAGCCATTACACTAAGG + Intergenic
931628147 2:64275585-64275607 CAGTGTGAGACATTGCAAGGTGG - Intergenic
932962236 2:76426865-76426887 AAGTCTTAGCCAGTGCAATAAGG - Intergenic
933066132 2:77799530-77799552 AAGTCTTACCCACTGCAATAAGG + Intergenic
933727715 2:85436004-85436026 CAGACTGAGCCATGGCAGGAGGG - Intronic
934163548 2:89274173-89274195 CAATCTGAGCCATTGTCCTATGG + Intergenic
934203725 2:89908351-89908373 CAATCTGAGCCATTGTCCTATGG - Intergenic
934905805 2:98201486-98201508 AAGTCTTAGCCAGTGCATTAAGG - Intronic
935177156 2:100659303-100659325 AAGTTTTAGTCATTGCAATAAGG - Intergenic
939772238 2:146335837-146335859 CAGTCTGATCCATTTAAATTTGG + Intergenic
944028693 2:195205178-195205200 CACTGAGAGCCAATGCAATAAGG + Intergenic
944378589 2:199078400-199078422 AAGTTTTAGCCATTGCAACATGG + Intergenic
945230922 2:207588995-207589017 AAGTCCTAGACATTGCAATAAGG - Intronic
1169169436 20:3452807-3452829 CAATGAGAGCCATTGAAATATGG - Intergenic
1169856652 20:10110656-10110678 CAGACTGAACCATGGCAATGGGG + Intergenic
1171147690 20:22800177-22800199 CAGAATGACCCATTACAATAAGG + Intergenic
1171276404 20:23859661-23859683 CAGTTTGAGTCACTTCAATAAGG + Intergenic
1172855498 20:37999076-37999098 CAGTATGTGACATTGCAATCGGG + Intronic
1173544805 20:43887310-43887332 CATTCTGATCCATGGTAATAAGG - Intergenic
1177077202 21:16590733-16590755 TAGTCTGAGCCATAGTTATATGG - Intergenic
1178966840 21:37128171-37128193 AAGTCAGAGCCAATGTAATAAGG - Intronic
1179877300 21:44275777-44275799 AAGTTTTAGCCAGTGCAATAAGG + Intergenic
1181367891 22:22392763-22392785 AAGTCCTAGCCATAGCAATAAGG + Intergenic
1182525549 22:30915612-30915634 TACTCAGAGCCAATGCAATAAGG + Intergenic
1183652525 22:39166242-39166264 AGGTCTTAGCCAGTGCAATAAGG - Intergenic
1184683255 22:46084405-46084427 TAGTCTGAGCCTTAGAAATAAGG - Intronic
950437894 3:12991725-12991747 CAGTTTCAGCCATTGGTATAAGG - Intronic
951282813 3:20773654-20773676 TAGTCTGAAACATTGGAATAAGG - Intergenic
952989421 3:38818727-38818749 AAGTGTGAGCCACTGCAATATGG + Intergenic
956931329 3:74046560-74046582 CAGTCTGAGACATTTTATTATGG + Intergenic
957030254 3:75232397-75232419 CTGTTTCAGCCATAGCAATATGG + Intergenic
957206182 3:77201639-77201661 CTGTATGTGACATTGCAATAGGG + Intronic
958970998 3:100610067-100610089 CAGTCTGAGGCATTCCACCAAGG + Intronic
959202424 3:103264793-103264815 AAGTTCTAGCCATTGCAATATGG + Intergenic
959741334 3:109723702-109723724 ATTTCTGAGACATTGCAATAGGG + Intergenic
959789244 3:110337335-110337357 CAGTCTTAGCCTTTGCTTTATGG - Intergenic
960497445 3:118392195-118392217 AAGTTTTAGCCAATGCAATAAGG + Intergenic
961501648 3:127340487-127340509 GTGTCTGTGCCCTTGCAATATGG + Intergenic
962148164 3:132863511-132863533 AAATCTTAGCCAGTGCAATAAGG - Intergenic
966013472 3:175111629-175111651 AAGTCTGAGCCTTTGCTTTAGGG - Intronic
966846757 3:184136417-184136439 GAGTCTGAGACATTGCAATTTGG - Intronic
967405478 3:189111812-189111834 AAGTCTAAGCCAGTGCAACAAGG - Intronic
968219062 3:196920528-196920550 CAGTCTTAGCCAGTGCAGTAAGG - Intronic
973088254 4:46096803-46096825 TAGTCTTACCCAGTGCAATATGG + Intronic
973093304 4:46165123-46165145 CAGTCATAACTATTGCAATAGGG - Intergenic
977198977 4:94092864-94092886 AAGTCTTAGCCAAAGCAATAAGG - Intergenic
980433391 4:132735536-132735558 CAGTTTGAGACAATGCAACATGG - Intergenic
982845134 4:160242990-160243012 AAGTCTTAGCCATAGCAATTAGG - Intergenic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985864171 5:2500127-2500149 CAGTTCAAGCCAATGCAATAAGG - Intergenic
986549935 5:8941346-8941368 AAGTCTCAGCCAAAGCAATACGG + Intergenic
988626451 5:32880639-32880661 AAGTCTGAGCCAGAGCAATTAGG - Intergenic
990307770 5:54509965-54509987 CAGTCTGAGTGGTTGCAGTATGG + Intergenic
991202461 5:64009928-64009950 CTATCTGAGTCAGTGCAATAAGG + Intergenic
992983450 5:82202111-82202133 AAGTCTTAGCCAGTGCAATGTGG - Intronic
993044411 5:82851124-82851146 CATACTGAGCCCTTGAAATATGG + Intergenic
996456628 5:123691762-123691784 GAGTCCTAGCTATTGCAATAGGG - Intergenic
997000735 5:129757488-129757510 CAATCTCTGTCATTGCAATAGGG + Intronic
997182246 5:131842307-131842329 AAGTCTGAGCCAGAGCAATTAGG - Intronic
997773661 5:136577974-136577996 CAGTTTAAGACATGGCAATATGG - Intergenic
998050770 5:139032090-139032112 CAGTCATAGCCAATGCAGTAAGG - Intronic
998192108 5:140034474-140034496 CAGTCCTAGCCAGTGTAATAAGG + Intronic
998515098 5:142745940-142745962 CTGTTTGAGCTATTGGAATATGG - Intergenic
999035855 5:148348686-148348708 TAGTCTGTGCCACTGAAATAGGG - Intergenic
1002544493 5:179930545-179930567 CAGTGTTAGCCATTACCATATGG - Intronic
1003215639 6:4107337-4107359 AAATCTTAGTCATTGCAATAAGG - Intronic
1003706192 6:8533454-8533476 TAGTCTAAACCACTGCAATAAGG - Intergenic
1004842629 6:19604820-19604842 CAATCTGAGTCAATGTAATAGGG + Intergenic
1005724226 6:28633385-28633407 CAGTCTGAGCCAGTTCAGAAAGG - Intergenic
1006574167 6:35031747-35031769 GACTCTGAACCATAGCAATAGGG - Intronic
1008959203 6:57248685-57248707 CAGTCTGATCCATTGCAGGAGGG + Intergenic
1012278920 6:97305633-97305655 CAGTCAGACACAATGCAATAGGG - Intergenic
1012491449 6:99787204-99787226 CTGTCTGAGCCATTTCTTTAAGG + Intergenic
1014472482 6:121833730-121833752 CTGTTTGACCTATTGCAATATGG + Intergenic
1015509595 6:134024546-134024568 CAGCCTGAGCAATTGCAGCAGGG - Intronic
1017061235 6:150486992-150487014 CAGTCTGAGCCAGTACAAGCTGG - Intergenic
1017555759 6:155565458-155565480 AAGTATCAGCCATTGCAGTAAGG - Intergenic
1022646539 7:32235256-32235278 AAGTCCTAGCCAGTGCAATAAGG + Intronic
1023904173 7:44510080-44510102 AGGTCTTAGCCATTGTAATAAGG - Intergenic
1024141501 7:46467293-46467315 CAGTCTGAGCCATTGGAGCCAGG + Intergenic
1026646347 7:72172944-72172966 AGGTCTTAGCCATTGCAATAAGG + Intronic
1028169217 7:87575657-87575679 CAGTTTGGGCCAATGCCATAGGG - Intronic
1032501929 7:132406066-132406088 CAGTCTGTCCCTTTGCAAAATGG - Intronic
1032740766 7:134736439-134736461 CAGACTGATCCTTTGCAAAATGG + Intergenic
1033355765 7:140598452-140598474 AAGTCTCAGCCAGTGCAATTTGG + Intronic
1034315664 7:150129375-150129397 CAGTCCTAGCCAGTGTAATAAGG + Intergenic
1035715061 8:1747603-1747625 CAGTGTGAGCCACTGCAACCTGG + Intergenic
1038582512 8:28761541-28761563 GAGTCCCAGTCATTGCAATAAGG - Intergenic
1039151139 8:34507074-34507096 AGGTCTGAGACAGTGCAATACGG - Intergenic
1042275301 8:66998553-66998575 CTGTCTTAGCCAGTGCAATAAGG - Intronic
1043130040 8:76448288-76448310 GAGTCAGAGTCATTGCAATCAGG + Intergenic
1045672349 8:104569792-104569814 AAGTCTTAGCCAATGCAATAAGG + Intronic
1045803189 8:106125250-106125272 CAGATTGAGTCATTGCAACAGGG - Intergenic
1046010091 8:108535856-108535878 CACTCTCAGCCTTTGCAATTTGG - Intergenic
1046056344 8:109083377-109083399 CAGTCTGAGTCAGTGCACAAGGG + Intergenic
1046908563 8:119601411-119601433 CAGGGTGAGCCACTGCAATATGG + Exonic
1048624069 8:136165081-136165103 CAGTCTCAGCCCTTGTAATTAGG + Intergenic
1049976654 9:866435-866457 CACTGTGATCCATTGCAAAAGGG + Intronic
1050638951 9:7644872-7644894 AAGTCCTAGCCATTGCAATCAGG - Intergenic
1051483383 9:17583045-17583067 CATTCTGAGCTATTGTAATTAGG + Intronic
1054703786 9:68441738-68441760 CAGACCCAGCCAATGCAATAAGG + Intronic
1054736158 9:68752444-68752466 CAGCCATAGCCATTGGAATATGG + Intronic
1056018752 9:82420174-82420196 CAGCCTGAGTCAGTGTAATATGG + Intergenic
1056032607 9:82568612-82568634 AACTCTGAGCCTTTGCAGTAGGG - Intergenic
1057573863 9:96224360-96224382 AAGTCCTAGCCAGTGCAATAAGG + Intergenic
1062256766 9:135627113-135627135 CAGTTCTAGCCACTGCAATAAGG + Intronic
1186411848 X:9350731-9350753 CATGATGAGGCATTGCAATATGG + Intergenic
1186438273 X:9562535-9562557 AAGTATGAGCCACTGAAATAAGG - Intronic
1188966875 X:36565075-36565097 CTGTCTGAGGCCTTGGAATATGG + Intergenic
1189190866 X:39103507-39103529 AAGTCTTAGCCTGTGCAATAAGG + Intergenic
1189196628 X:39159162-39159184 CACTCTGAGTCATTGCAACAAGG + Intergenic
1189428199 X:40921822-40921844 AAGTCCTAGCCAGTGCAATAAGG + Intergenic
1189576685 X:42361198-42361220 GAGTCTGAACCATGGCAATCTGG - Intergenic
1193230768 X:79042759-79042781 AAGTTTGAGCCAGTGCAATAAGG - Intergenic
1193374911 X:80747956-80747978 AAGTCTGAGCCAGTGCATTTAGG - Intronic
1194004365 X:88472145-88472167 CAGTCTGAGTGATTGAAGTATGG + Intergenic
1194337095 X:92661113-92661135 TAATTTGAGCCATTGCAGTAGGG - Intergenic
1194380621 X:93186616-93186638 GAGTCCTAGCCAGTGCAATAAGG + Intergenic
1195970067 X:110463155-110463177 CACTCTGAGCCATTGCTAGAGGG + Intergenic
1197412152 X:126131046-126131068 CAGTCCTAGCCATAGCAATTAGG - Intergenic
1199658259 X:150020514-150020536 AAGTCTTAGCCAATGCAATAAGG - Intergenic
1200376932 X:155791996-155792018 AAGTCCCAGCCATTGCAATAAGG + Intergenic
1202245258 Y:22813480-22813502 CTGTCTGAGCCTTTACAATGGGG + Intergenic
1202398248 Y:24447226-24447248 CTGTCTGAGCCTTTACAATGGGG + Intergenic
1202472533 Y:25222860-25222882 CTGTCTGAGCCTTTACAATGGGG - Intergenic