ID: 1121398852

View in Genome Browser
Species Human (GRCh38)
Location 14:93653833-93653855
Sequence CTGTTCCAAAGCACGATCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121398842_1121398852 26 Left 1121398842 14:93653784-93653806 CCTGCGCTGCATCTTCCATCAGT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1121398845_1121398852 11 Left 1121398845 14:93653799-93653821 CCATCAGTTGGCCCCCAACGGCA 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1121398849_1121398852 -3 Left 1121398849 14:93653813-93653835 CCAACGGCATCTTCCCGCAGCTG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1121398846_1121398852 0 Left 1121398846 14:93653810-93653832 CCCCCAACGGCATCTTCCCGCAG 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1121398848_1121398852 -2 Left 1121398848 14:93653812-93653834 CCCAACGGCATCTTCCCGCAGCT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1121398847_1121398852 -1 Left 1121398847 14:93653811-93653833 CCCCAACGGCATCTTCCCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121398852 Original CRISPR CTGTTCCAAAGCACGATCAA AGG Exonic
900247854 1:1647085-1647107 CTGTACCAAAGCACGTCGAATGG - Intronic
900259080 1:1714239-1714261 CTGTACCAAAGCACGTCGAATGG - Intronic
906360161 1:45149511-45149533 ATGTTACAAAGCACTATCAAGGG + Intronic
907985984 1:59530966-59530988 CAGTTCCAAGGCAGTATCAATGG + Intronic
909553231 1:76923335-76923357 CTGTTCCAAACCCCGTCCAATGG - Intronic
917693649 1:177495561-177495583 CTGTCCCACAGCACACTCAAAGG + Intergenic
918975645 1:191482036-191482058 CTGATCCAAAATAGGATCAAAGG - Intergenic
919346909 1:196393731-196393753 CAGTTGCAAACCACGATTAAAGG - Intronic
921876048 1:220197624-220197646 CTCCACCAAAACACGATCAAAGG + Intronic
923410930 1:233708272-233708294 TTGTTCCAAAGCTCTATAAAAGG + Intergenic
924429315 1:243983304-243983326 CAGTTTCAAAACACAATCAATGG + Intergenic
1071416432 10:85446011-85446033 CTGCTCCACACCACGATTAAGGG + Intergenic
1071473871 10:86008121-86008143 CTGTTACATAGCAGGATCAGGGG - Intronic
1085067026 11:73505892-73505914 CTGGACCAAATCAAGATCAAAGG + Intronic
1096338275 12:50774424-50774446 CGCTTCAAAAGCACCATCAATGG - Intronic
1096798922 12:54096551-54096573 CTCTTTGAAAGCTCGATCAATGG + Intergenic
1097689833 12:62724382-62724404 CTGGTTTAAAGCACCATCAAAGG - Intronic
1100018030 12:90035599-90035621 GTGATCCAAAGCATGATCACAGG + Intergenic
1102052835 12:109875526-109875548 CTGTTCTAAAGCATTAACAATGG - Intronic
1102414890 12:112752506-112752528 CTGTTCAAAACCACAATCATTGG + Intronic
1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG + Intronic
1107987757 13:45790310-45790332 CTGTTTCAAACCAAGATCTATGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1114910215 14:27184302-27184324 CTTATCCAAAACACCATCAAAGG + Intergenic
1117627390 14:57653800-57653822 CTGTAACAAAGCACCATAAACGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119177420 14:72579442-72579464 CTCTTCCACAGCTCTATCAAGGG + Intergenic
1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG + Exonic
1125520743 15:40346647-40346669 CTGTTCCCACGCACCAACAATGG + Intergenic
1126828615 15:52576190-52576212 CTGTTCCAATCCATGAGCAAGGG + Intergenic
1128783289 15:70376918-70376940 CTGTTCCAAGGCAGGAGGAAAGG + Intergenic
1128858061 15:71037608-71037630 CTAGTCCAAAGCAGGACCAAGGG + Intronic
1130438957 15:83931651-83931673 CTGTTCCAAATACAGATCAATGG + Intronic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1150678327 17:67263977-67263999 GTGTTCCAACGCAAGATAAAAGG - Intergenic
1155422425 18:25669489-25669511 CTTTTCCAAAGCACAAGTAAAGG + Intergenic
1155422441 18:25669649-25669671 CTTTTCCAAAGCACAAGTAAAGG + Intergenic
1158410962 18:57205823-57205845 CTTTTCCAAAGCACACTGAATGG - Intergenic
1160039591 18:75333611-75333633 CTGTTCCAAACCCAGCTCAAAGG + Intergenic
1168122365 19:54258893-54258915 CTGTCCACAAGCACGAGCAAGGG - Intronic
925986999 2:9224795-9224817 CTGTCCCAAAGATGGATCAATGG - Intronic
937160537 2:119757162-119757184 CTCTCCCAAAGCACAGTCAAGGG + Intergenic
937441086 2:121916833-121916855 CTGTCCCATAGCATGATCTAGGG + Intergenic
939704509 2:145435893-145435915 CTATTCCAAACAAGGATCAATGG + Intergenic
942508599 2:176671328-176671350 CAGTTCCAAACCAAAATCAAAGG + Intergenic
1169949505 20:11027675-11027697 CTGAGCCAAAGCAAGATAAAGGG - Intergenic
1171797500 20:29577799-29577821 CTCTTTGAAAGCTCGATCAATGG - Intergenic
1171850752 20:30306362-30306384 CTCTTTGAAAGCTCGATCAATGG + Intergenic
1173164555 20:40677742-40677764 ATGTTCCTAAGAACGATAAATGG - Intergenic
1174891258 20:54397646-54397668 CTGTTCAAAAACACAATAAATGG - Intergenic
1179487358 21:41718932-41718954 CTGTTCCAAAGCACTATCTGAGG + Intergenic
1180151205 21:45948982-45949004 CTCTTCCAAAGCAGGATGGACGG - Intergenic
1182104233 22:27677861-27677883 CTGGTCCAGAGCAGGAGCAAAGG + Intergenic
959829810 3:110847303-110847325 CTGTTCCAAATTTCAATCAAGGG + Intergenic
961506085 3:127371380-127371402 CTTTTCCAAAGCACAAAAAAGGG - Intergenic
964912283 3:161797896-161797918 CTGTGCCAAAGCACAAAGAAAGG - Intergenic
969478937 4:7436757-7436779 TTGTTCCAAAGGCCCATCAAGGG - Intronic
977847693 4:101785373-101785395 CTTTTCCAAAGCACTAAGAAAGG - Intronic
980511703 4:133799240-133799262 CTTTTCCAAAGCAAAATAAATGG + Intergenic
986839494 5:11679933-11679955 ATGTTCTAAAGCACAATCACAGG + Intronic
987061587 5:14248691-14248713 CTGTTCCAAAGCACAGCCCAGGG - Intronic
987935252 5:24455685-24455707 CGGTTCCAGAGCACAATAAAGGG + Intergenic
992885029 5:81150051-81150073 CTGTTCCAAAGGACAATGGATGG + Intronic
995370696 5:111415667-111415689 ATGTTGCAAAGAATGATCAATGG + Intronic
1001264303 5:170261581-170261603 CTGTTTTAAAGCAAGAGCAAGGG - Intronic
1002531595 5:179849814-179849836 CTGTGCCATAGCACGACCCATGG - Intronic
1005397801 6:25401639-25401661 GTGTTTCAAAGCAAGATTAATGG + Intronic
1007905185 6:45452936-45452958 CCCTTCCAAAGCACCATCACTGG + Intronic
1020430939 7:8115552-8115574 TTGTCCCAAAGCACAATCACTGG - Intronic
1020976402 7:15012475-15012497 ATGTTCCAAAGCAGGAGCAGGGG - Intergenic
1026472297 7:70704053-70704075 CTGTTTCCAAGAACGCTCAAAGG - Intronic
1029738700 7:102479242-102479264 CGTTTCCAAAGAAAGATCAAGGG - Intergenic
1030917944 7:115340175-115340197 CAGTTCTGAAGGACGATCAAGGG + Intergenic
1033030205 7:137819071-137819093 ATGGTCAAAAGCACGATCAAAGG + Intronic
1038417858 8:27410369-27410391 CTGTCCCAAATCAGGATGAAAGG + Intronic
1040039508 8:42902114-42902136 ATGATCCAAAGCACTATGAAAGG - Intronic
1042012945 8:64269948-64269970 TTGTTCCAGAGCACGCTCAGAGG + Intergenic
1043269325 8:78310081-78310103 CTGTTTTAAAGCAAGAACAATGG - Intergenic
1045448437 8:102292537-102292559 ATGTTCCAGAACAAGATCAAGGG + Intronic
1053788530 9:41669654-41669676 CTCTTTGAAAGCTCGATCAATGG + Intergenic
1054156609 9:61645114-61645136 CTCTTTGAAAGCTCGATCAATGG - Intergenic
1054176815 9:61880993-61881015 CTCTTTGAAAGCTCGATCAATGG + Intergenic
1054476379 9:65576123-65576145 CTCTTTGAAAGCTCGATCAATGG - Intergenic
1054660720 9:67699813-67699835 CTCTTTGAAAGCTCGATCAATGG - Intergenic
1187699348 X:21950031-21950053 GTTTTCCAAAGCATGATCCAAGG - Intronic