ID: 1121402286

View in Genome Browser
Species Human (GRCh38)
Location 14:93690413-93690435
Sequence GTTGTGTTTCTAACATCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402286 Original CRISPR GTTGTGTTTCTAACATCCAC AGG (reversed) Intronic
903067295 1:20707446-20707468 GTTATGTTTAAAACATTCACAGG + Intronic
904311039 1:29629815-29629837 GCTGTGTTCCTGACACCCACTGG + Intergenic
906534952 1:46546280-46546302 TTGGTTTTTCCAACATCCACTGG + Intronic
907251832 1:53144612-53144634 GTTGTGTTTCTAGTACCCAGGGG - Intergenic
911092422 1:94028456-94028478 GCTGTGTCTCTAACATCTGCAGG - Intronic
911885724 1:103296701-103296723 GTGGTGGTTCTAACATCCTAAGG + Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
916925764 1:169519118-169519140 GCTGTGTTTCTTACAGTCACAGG - Intronic
919249963 1:195041724-195041746 TTTGTGGTTATAACATACACAGG - Intergenic
920034151 1:203055281-203055303 GATGTGTTTCTAAGCTCCAGTGG + Intronic
921455044 1:215360739-215360761 GTGGTCTTTCTAACAAACACAGG - Intergenic
923380235 1:233410430-233410452 CTTTTATTTCTAACTTCCACTGG + Intergenic
1067264644 10:44728706-44728728 GTTCTGTTTCTAACTTCCTTAGG + Intergenic
1067337764 10:45378703-45378725 GCTGTGGTTCTAACATCCCAGGG - Intronic
1067660664 10:48234449-48234471 GTTTTGTTCCCAACACCCACAGG + Intronic
1070532372 10:77348304-77348326 TTTGTGTTTCCAACAGCCAATGG - Intronic
1070567820 10:77617058-77617080 GTTGCCTTTCTAAAATCCAATGG - Intronic
1073794523 10:106973371-106973393 GTTGGGTTTCTAAATTTCACTGG - Intronic
1073828953 10:107359639-107359661 GTTGTTGTTCTGACATCCAGAGG - Intergenic
1074389673 10:113046254-113046276 GTTGTGATTCCAACATGCAGGGG - Intronic
1074501481 10:114028869-114028891 GTGGTGTTTAGGACATCCACAGG + Intergenic
1082002009 11:47398414-47398436 AATGTGTTTCTAACAGCCATGGG + Intergenic
1082936511 11:58662114-58662136 GTATTGTTTCTAATATCCAGGGG - Intronic
1085689501 11:78653790-78653812 GTTGTGTTTCTTACCCCCTCTGG - Exonic
1086225591 11:84504704-84504726 CTTGTATTTCTAACAAGCACTGG - Intronic
1090986932 11:131775962-131775984 ATTGTGTTTCCAGCATCCACGGG + Intronic
1091428513 12:412566-412588 GTTGTGTTACTGGCATCCAGCGG - Intronic
1091772755 12:3163866-3163888 GGTGAGTCTCTAATATCCACAGG - Intronic
1095132935 12:38565216-38565238 TTTGTGGTCCTATCATCCACAGG - Intergenic
1101465508 12:104944790-104944812 AGTGTGTTTCTAATATCCACTGG + Intronic
1106434777 13:29713691-29713713 TCTGTGTTTCTAACATGCTCCGG - Intergenic
1108750403 13:53442365-53442387 CTTGTGTTTACAACAACCACAGG - Intergenic
1109239805 13:59871899-59871921 GTTATCTTTTTAACATCCATAGG + Intronic
1109409176 13:61942029-61942051 GATGTGTTGTTAACATCCAGCGG - Intergenic
1110117638 13:71839699-71839721 TATATGTTTCTAACATCCCCTGG + Intronic
1110824822 13:79959402-79959424 GTTGTGTTTATCACCTCCATTGG - Intergenic
1111331486 13:86764877-86764899 CTTTTGATTCTAACATCCTCAGG - Intergenic
1116516939 14:45815646-45815668 ATATTGTTTCTAACATCCGCAGG + Intergenic
1116518062 14:45822812-45822834 ATATTGTTTCTAACATCCATGGG + Intergenic
1117050831 14:51857982-51858004 CTTGTATTTCTTACATCTACTGG - Intronic
1117127399 14:52644863-52644885 ATTGTGTCTCTAGCATCCAAGGG - Intronic
1118160600 14:63286037-63286059 GCTGGGTTTTTAACATGCACAGG + Intronic
1120633293 14:86918403-86918425 GTAGTTTTTCTAACTTCCATTGG + Intronic
1120716655 14:87847844-87847866 GTATTGTTTCAAACATCCAGTGG - Intronic
1121402286 14:93690413-93690435 GTTGTGTTTCTAACATCCACAGG - Intronic
1125207480 15:37170733-37170755 ATTGTGTTGCTCACATACACTGG - Intergenic
1127393953 15:58528734-58528756 CTTGAGTTTCTTCCATCCACGGG + Intronic
1129493845 15:75957611-75957633 GTTAGGCTTCTAACATCTACGGG + Intronic
1130185354 15:81675754-81675776 GTTGTGTTTATAATATCTACTGG - Intergenic
1131677187 15:94682527-94682549 TCTGTCTTTCTAACAACCACAGG - Intergenic
1135960631 16:26991923-26991945 CTTGTCTTTCCAGCATCCACAGG + Intergenic
1139099904 16:63753213-63753235 TATGAGTTTCTAACATACACAGG + Intergenic
1143329831 17:6125473-6125495 GTTGTGCTTATAATATCAACTGG - Intergenic
1143663267 17:8340400-8340422 ATTCTGTTGCTGACATCCACGGG - Exonic
1144026703 17:11283370-11283392 GTTTTGGTTTTAATATCCACTGG - Intronic
1147646038 17:42034469-42034491 TTTCTCTTTCCAACATCCACAGG - Intronic
1151012841 17:70520922-70520944 GTTCTGTTTCTAAAATCCTTAGG + Intergenic
1158644863 18:59237140-59237162 GAGGGGTTTCTAACAGCCACAGG - Intergenic
1160146020 18:76365458-76365480 GTTTTTCCTCTAACATCCACAGG + Intronic
1160477324 18:79203510-79203532 ATTCTTTTTCTAATATCCACAGG - Intronic
1166236420 19:41460333-41460355 ATATTGTTTCTAACATCCAGTGG - Intergenic
930455597 2:51604710-51604732 GTTGTGTTTTTCAGCTCCACTGG + Intergenic
936374765 2:111930935-111930957 TTTGTGCTTTTAACAACCACAGG - Intronic
936557401 2:113508519-113508541 ATATTGTTTCTAACATCCAGAGG - Intergenic
936557494 2:113509081-113509103 ATATTGTTCCTAACATCCACAGG - Intergenic
937415492 2:121711238-121711260 GTGGAGTGTCTTACATCCACAGG - Intergenic
940816687 2:158304965-158304987 CTTGTGTTTGTAGCTTCCACAGG - Intronic
941265441 2:163356044-163356066 GTTGTGTATCTTACCACCACTGG - Intergenic
941533627 2:166696991-166697013 GTATTGTTTCTAATATCCAATGG + Intergenic
943418011 2:187632514-187632536 TTTGAGTGTCTAACATCTACAGG - Intergenic
943626086 2:190201454-190201476 ATTGTGGATCTAACATACACAGG - Exonic
945028374 2:205641228-205641250 TTTTTGTTTCTAAAATGCACGGG + Intergenic
948898284 2:240939488-240939510 GTTGTGCTCCTAAAATACACTGG + Intronic
1171084029 20:22219393-22219415 TCTGTTTTTCTAACATTCACTGG + Intergenic
1173140903 20:40481941-40481963 GTTGTTTTGCTAACATGCATAGG + Intergenic
1173552588 20:43943203-43943225 GTTGTGATCGTACCATCCACAGG - Intronic
1173706757 20:45115631-45115653 GTGGTCTTTCTCCCATCCACAGG - Intergenic
1177180731 21:17742141-17742163 GTTCTGGTTCTAAGACCCACCGG + Intergenic
1182468926 22:30535192-30535214 CATTTGTTTATAACATCCACTGG - Intronic
951743328 3:25948283-25948305 CTTGTATTTTTAAGATCCACAGG - Intergenic
956229347 3:66997226-66997248 CTTGTGTTTCTAACATCTAACGG - Intergenic
957962075 3:87269067-87269089 GCTGTGCTTGTAACATGCACAGG + Intronic
958136086 3:89494086-89494108 GTAGTGTTTAAAACATCCAGAGG - Intergenic
959743633 3:109750453-109750475 ATTGTGTTTCTATCACTCACTGG - Intergenic
960724657 3:120658346-120658368 GCTGTGTTTCAGACATGCACGGG - Intronic
961202197 3:125054187-125054209 GCTGTTTTGCTAACTTCCACGGG - Intronic
961775819 3:129284489-129284511 GTTATGTTTCTAACAGCATCTGG - Intronic
962120031 3:132551582-132551604 TTTGTGTTTTTAACAGCTACGGG + Intergenic
965241977 3:166213189-166213211 ATTCTGTTTATAACATTCACAGG + Intergenic
967472672 3:189880535-189880557 GTTGTTTTTCTAAAATTCACAGG + Intronic
970513827 4:16807416-16807438 GTTCTGTTTCTCACACACACAGG - Intronic
970728588 4:19076439-19076461 GTGGTGTTTCTGAGTTCCACAGG - Intergenic
972266913 4:37469514-37469536 TTTCTGATTCTAAGATCCACTGG - Intronic
973012838 4:45097900-45097922 GTTGTCTTTAAAAAATCCACAGG + Intergenic
973688341 4:53398133-53398155 GTTGTGTTTCTATCAGCTTCTGG + Intronic
975813035 4:78189513-78189535 GATGTGTTTCTATCATCCCAAGG + Intronic
982813194 4:159852658-159852680 GTACTGTGTCTAATATCCACAGG + Intergenic
982875516 4:160643727-160643749 GTTTTGTCTCTCACTTCCACAGG - Intergenic
985387466 4:189462572-189462594 AATTTGTTTCTACCATCCACAGG - Intergenic
986084000 5:4424564-4424586 ATTGTGGATCTAACATGCACGGG + Intergenic
989393207 5:40924230-40924252 GTTGTGTTTCAGACTTCCATGGG - Intronic
993646694 5:90472011-90472033 GTTGGGATTCTACCATCAACTGG + Intronic
994392972 5:99207069-99207091 GTATTGTTTCTAATATCCAAGGG - Intergenic
994393155 5:99208349-99208371 GGGGTGTTTCTAATATCCAGGGG - Intergenic
994393798 5:99212372-99212394 ATTTTGTTTCTAATATCCAAAGG - Intergenic
994395991 5:99226155-99226177 ATATTGTTTCTAATATCCACGGG - Intergenic
994502063 5:100591420-100591442 GTTTTATTTCTTGCATCCACAGG + Intergenic
995649683 5:114356377-114356399 GTTGTGTTTCTAGCTGCCAAAGG + Intergenic
997601923 5:135145465-135145487 GCTGTGTTTGTAACATTCATTGG + Intronic
997683660 5:135773815-135773837 ATTTTGTTTCTAATATCCAGAGG + Intergenic
998004618 5:138648829-138648851 AATGTGTTTCCAACATCCCCTGG + Intronic
999081255 5:148845866-148845888 GTTGAGTTTCTAACATTTCCTGG + Intergenic
999365674 5:151021871-151021893 CTTTTGTTTCTAAAATCCTCTGG + Intronic
1001782286 5:174380289-174380311 GTATTGTTTCTAACACCCTCAGG - Intergenic
1003557211 6:7150849-7150871 GGTGTGCTTGTAACATCCGCCGG + Intronic
1004173958 6:13322665-13322687 GTTTTTTTTCTAACATTAACTGG - Intronic
1005675184 6:28147145-28147167 TTTGAGTTTCTTACATCCTCTGG - Intronic
1009050088 6:58264655-58264677 ATATTGTTTCTAACATCCAGAGG - Intergenic
1010350707 6:74870983-74871005 GTTGTGGTTGTAACATCTTCAGG - Intergenic
1011569879 6:88724176-88724198 GCTGTGTTTATAAAATCTACAGG + Intronic
1012775294 6:103488612-103488634 ATATTGTTTCTAATATCCACGGG + Intergenic
1013945162 6:115714343-115714365 TTTGTTTTTCTAGCATCAACTGG + Intergenic
1017393587 6:153970145-153970167 TTTGTGTTACCAACTTCCACAGG - Intergenic
1017415676 6:154218038-154218060 GTTTTCTTTCTAGGATCCACTGG + Intronic
1018671894 6:166185485-166185507 GTTGTGTGTCTAACATGCTTTGG - Intergenic
1020335072 7:7056866-7056888 ATTTTGTTTGTAACATCCACGGG + Intergenic
1022858553 7:34341405-34341427 GTTGTATTTCAAACAGCCTCAGG + Intergenic
1028192792 7:87871978-87872000 GTTGTCATTTTAACATCCATTGG + Intronic
1029301618 7:99586057-99586079 ATATTGTTTCTAATATCCACAGG - Intronic
1031661746 7:124434754-124434776 TTTGTCTTTCTGACATCCAAAGG + Intergenic
1032590728 7:133189938-133189960 GTTTTTTTTTTAAAATCCACAGG - Intergenic
1034887661 7:154810386-154810408 GCTGTGTTTCTATCTACCACGGG - Intronic
1035446213 7:158944905-158944927 GGCGTGTTTCTACCAGCCACAGG + Intronic
1035562885 8:619694-619716 GTTGGGTTTGTAACATATACAGG + Intronic
1036820048 8:11932998-11933020 GTGTTGTTTCAAATATCCACTGG + Intergenic
1037052540 8:14394320-14394342 TTTGTGTTTCTAACAGAGACTGG + Intronic
1042456869 8:69015408-69015430 GTTGTGTTTCTCACAGGCACTGG + Intergenic
1043633733 8:82366694-82366716 GTATTGTTCCTAATATCCACTGG + Intergenic
1044444358 8:92257192-92257214 TTTGTGTTTCTAACAGAGACAGG - Intergenic
1045593395 8:103625045-103625067 GTTTTGTTTCTTACTTCAACTGG + Intronic
1045927089 8:107586719-107586741 GTGATGTTTCTAATATCCAGAGG - Intergenic
1046727322 8:117689918-117689940 GTTGCCTCTCTAACATCCTCTGG - Intergenic
1049222974 8:141436255-141436277 GATGTGATTCTTACATCCTCAGG - Intergenic
1049851532 8:144834097-144834119 GTTGAGTTCCTAAAAGCCACTGG + Intronic
1049895516 9:108217-108239 ATATTGTTCCTAACATCCACAGG + Intergenic
1049895604 9:108780-108802 ATATTGTTTCTAACATCCAGAGG + Intergenic
1051233223 9:14974060-14974082 GATATGTTTGTAATATCCACAGG - Intergenic
1053738675 9:41118317-41118339 ATATTGTTCCTAACATCCACAGG + Intergenic
1053738779 9:41118958-41118980 ATATTGTTTCTAACATCCAGAGG + Intergenic
1054689565 9:68312357-68312379 ATATTGTTTCTAACATCCAGAGG - Intergenic
1054689670 9:68312998-68313020 ATATTGTTCCTAACATCCACAGG - Intergenic
1055821171 9:80266339-80266361 GTTATGTTGCTTACATACACAGG - Intergenic
1203566933 Un_KI270744v1:99973-99995 GTATTGTTTCTAATATCCATGGG + Intergenic
1186614900 X:11175996-11176018 GATCTTTTTCTATCATCCACTGG + Intronic
1188265459 X:28067860-28067882 GTTGTGTTTCTCACATTCAGTGG - Intergenic
1193472305 X:81921794-81921816 GTTCAGTTTCAGACATCCACTGG + Intergenic
1195927362 X:110039218-110039240 TTTATGTTTGTAACAACCACAGG + Intronic