ID: 1121402543

View in Genome Browser
Species Human (GRCh38)
Location 14:93692883-93692905
Sequence GTGTCCCCATAACAAGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121402543_1121402551 21 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402551 14:93692927-93692949 TGAGGAGCAGGGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 451
1121402543_1121402548 11 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402548 14:93692917-93692939 TTCTTGTTTGTGAGGAGCAGGGG 0: 1
1: 0
2: 0
3: 35
4: 271
1121402543_1121402549 17 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402549 14:93692923-93692945 TTTGTGAGGAGCAGGGGACCTGG 0: 1
1: 0
2: 1
3: 30
4: 325
1121402543_1121402545 3 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402545 14:93692909-93692931 CAATAGAGTTCTTGTTTGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 176
1121402543_1121402550 20 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402550 14:93692926-93692948 GTGAGGAGCAGGGGACCTGGAGG 0: 1
1: 0
2: 7
3: 81
4: 634
1121402543_1121402546 9 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402546 14:93692915-93692937 AGTTCTTGTTTGTGAGGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 171
1121402543_1121402547 10 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402547 14:93692916-93692938 GTTCTTGTTTGTGAGGAGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402543 Original CRISPR GTGTCCCCATAACAAGACGC TGG (reversed) Intronic