ID: 1121402544

View in Genome Browser
Species Human (GRCh38)
Location 14:93692905-93692927
Sequence ACAAACAAGAACTCTATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121402544_1121402550 -2 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402550 14:93692926-93692948 GTGAGGAGCAGGGGACCTGGAGG 0: 1
1: 0
2: 7
3: 81
4: 634
1121402544_1121402551 -1 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402551 14:93692927-93692949 TGAGGAGCAGGGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 451
1121402544_1121402549 -5 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402549 14:93692923-93692945 TTTGTGAGGAGCAGGGGACCTGG 0: 1
1: 0
2: 1
3: 30
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402544 Original CRISPR ACAAACAAGAACTCTATTGA TGG (reversed) Intronic