ID: 1121402549

View in Genome Browser
Species Human (GRCh38)
Location 14:93692923-93692945
Sequence TTTGTGAGGAGCAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121402544_1121402549 -5 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402549 14:93692923-93692945 TTTGTGAGGAGCAGGGGACCTGG 0: 1
1: 0
2: 1
3: 30
4: 325
1121402543_1121402549 17 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402549 14:93692923-93692945 TTTGTGAGGAGCAGGGGACCTGG 0: 1
1: 0
2: 1
3: 30
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402549 Original CRISPR TTTGTGAGGAGCAGGGGACC TGG Intronic