ID: 1121402550

View in Genome Browser
Species Human (GRCh38)
Location 14:93692926-93692948
Sequence GTGAGGAGCAGGGGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 7, 3: 81, 4: 634}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121402543_1121402550 20 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402550 14:93692926-93692948 GTGAGGAGCAGGGGACCTGGAGG 0: 1
1: 0
2: 7
3: 81
4: 634
1121402544_1121402550 -2 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402550 14:93692926-93692948 GTGAGGAGCAGGGGACCTGGAGG 0: 1
1: 0
2: 7
3: 81
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402550 Original CRISPR GTGAGGAGCAGGGGACCTGG AGG Intronic