ID: 1121402551

View in Genome Browser
Species Human (GRCh38)
Location 14:93692927-93692949
Sequence TGAGGAGCAGGGGACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121402544_1121402551 -1 Left 1121402544 14:93692905-93692927 CCATCAATAGAGTTCTTGTTTGT 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1121402551 14:93692927-93692949 TGAGGAGCAGGGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 451
1121402543_1121402551 21 Left 1121402543 14:93692883-93692905 CCAGCGTCTTGTTATGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121402551 14:93692927-93692949 TGAGGAGCAGGGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121402551 Original CRISPR TGAGGAGCAGGGGACCTGGA GGG Intronic