ID: 1121403470

View in Genome Browser
Species Human (GRCh38)
Location 14:93703225-93703247
Sequence CTGGCTTCCCAGGACTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 2, 2: 1, 3: 12, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121403461_1121403470 26 Left 1121403461 14:93703176-93703198 CCAATGAGCTTCGCCATGCCTTC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243
1121403466_1121403470 -6 Left 1121403466 14:93703208-93703230 CCTGGAATGCCCTTGTTCTGGCT 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243
1121403460_1121403470 29 Left 1121403460 14:93703173-93703195 CCACCAATGAGCTTCGCCATGCC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243
1121403459_1121403470 30 Left 1121403459 14:93703172-93703194 CCCACCAATGAGCTTCGCCATGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243
1121403464_1121403470 8 Left 1121403464 14:93703194-93703216 CCTTCTCTCTGCTTCCTGGAATG 0: 1
1: 2
2: 6
3: 76
4: 608
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243
1121403462_1121403470 13 Left 1121403462 14:93703189-93703211 CCATGCCTTCTCTCTGCTTCCTG 0: 1
1: 2
2: 17
3: 157
4: 1284
Right 1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG 0: 1
1: 2
2: 1
3: 12
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121403470 Original CRISPR CTGGCTTCCCAGGACTACCA AGG Intronic
900640954 1:3687861-3687883 CTGGGTTCCCGGGGCTCCCAGGG - Intronic
900867439 1:5278367-5278389 CTGGGTTGCCAGGAGTGCCATGG - Intergenic
902302824 1:15514624-15514646 CGGGCTTGCCATGTCTACCACGG + Intronic
903173934 1:21569708-21569730 CAGGGGTCCCAGCACTACCAAGG - Intronic
903283577 1:22263769-22263791 CTGGCTGCCCAAGACCAACAGGG - Intergenic
903342066 1:22660861-22660883 CTGGATTCCCAGGAATCCCTGGG - Exonic
904004619 1:27357232-27357254 CTAGCTTCCCAGGCCTTCCCTGG - Intronic
904372055 1:30054703-30054725 CTAGATTCCCAGGAATACCTTGG - Intergenic
904377507 1:30090890-30090912 CTGCATTCCCAGGGCTACGAGGG + Intergenic
904476676 1:30769469-30769491 GGGGCTTCCCAGGACCAACACGG + Intergenic
905793789 1:40803998-40804020 CTGGGTTCTCAGTACTTCCAGGG - Intronic
908775834 1:67639031-67639053 CTGGCTTCCCAGGAATCCTCAGG - Intergenic
909433782 1:75617035-75617057 CTGGCGTCCCAGAACTGCAAGGG + Intergenic
910327097 1:86022264-86022286 TTGGTTTACCAGGACCACCAGGG - Exonic
910545298 1:88408876-88408898 TTGGCTTCCCTGGACTACACTGG + Intergenic
914991311 1:152501739-152501761 CTGGCATCCCAGGGAGACCAAGG + Intergenic
915565849 1:156712294-156712316 CTGGTCTCCCAGGAGTCCCAGGG + Intergenic
917736592 1:177926782-177926804 CTCCCTTCCCAAGATTACCAGGG + Intronic
921028861 1:211318716-211318738 CTGGCTTCCTAGCACTGCTAAGG - Intergenic
923824590 1:237485858-237485880 ATGGCTTCCCAGACCTTCCAAGG - Intronic
1062852199 10:753265-753287 CTGGCTTTCCAGGGCTCCCTTGG - Intergenic
1067851918 10:49759885-49759907 CTGGCTTCCAAGTACTGCCCAGG + Intronic
1070249614 10:74762712-74762734 CTGGCTGCCCATGACTGTCAGGG - Intergenic
1071400202 10:85261365-85261387 CTGGCTTCCCATGACAACTTTGG + Intergenic
1074014544 10:109520792-109520814 CTAGTTTACCAGGACTATCAGGG + Intergenic
1074165023 10:110867507-110867529 CTCCATTCCCAGGACTCCCATGG + Intergenic
1074199752 10:111224353-111224375 CTGGCTTCCCAGGTCTCCATGGG - Intergenic
1075669877 10:124257029-124257051 GTGGATTCTCAGGCCTACCATGG - Intergenic
1076081007 10:127580603-127580625 CTGGCATCCCAGGTCTTCCCCGG + Intergenic
1076307685 10:129476511-129476533 CTGGGTTCCCAGGAATCCCATGG + Intronic
1076836949 10:133025902-133025924 CTGGCCTCCCAGGCCCACCCGGG - Intergenic
1077341725 11:2029210-2029232 CTGGCTTCCCAGGACTGCCAGGG + Intergenic
1077395656 11:2319887-2319909 CTGGCTTCTCAGGACCACTCAGG - Intergenic
1078857895 11:15221347-15221369 CTGGCTTCCCAGAACAGCCCAGG - Intronic
1080306508 11:30842913-30842935 CAGGCTTCAGAGGATTACCATGG - Intronic
1080375170 11:31700623-31700645 CTGTCTTCCAAGGACTACTGGGG - Intronic
1083410342 11:62488351-62488373 CTGGCTTCCCAGTGCTTACATGG - Intronic
1083498437 11:63080172-63080194 CTGCCTTCCCAGGAATGCCCAGG - Intronic
1083518978 11:63289400-63289422 CTGGATTCCCAAAACTAACATGG + Intronic
1083694447 11:64433295-64433317 CTGTCTTCCCAGGAGCTCCAAGG + Intergenic
1083731976 11:64657196-64657218 CTTGCTCCCCAGGACTTGCAGGG - Intronic
1084520147 11:69657844-69657866 CTGGCTTCTCTGGACTCCCATGG - Intronic
1088811030 11:113392473-113392495 CTGGCTTCCCAGGGAGACCCCGG + Intronic
1089070371 11:115695417-115695439 CTGGCTTCTCAGGAAGACTAAGG + Intergenic
1202824711 11_KI270721v1_random:84399-84421 CTGGCTTCCCAGGACTGCCAGGG + Intergenic
1091803984 12:3342975-3342997 CTGGTTTCCCAGGATTGCCCAGG - Intergenic
1092003557 12:5050363-5050385 CTTTCTTCCCAGGTCTACCGTGG - Intergenic
1092810266 12:12266460-12266482 CTGGCTTCCCAGACCTTCCCCGG - Intronic
1093158945 12:15722115-15722137 TTGGCTTCCCTGGGCTACAATGG + Intronic
1098752690 12:74315718-74315740 CTGGCTGCCCAGAACTAGAAGGG + Intergenic
1098867857 12:75783192-75783214 CTGGGTTTCCAGGACCACAAAGG + Intergenic
1100235908 12:92660533-92660555 TTGGCTTCCCTGGACCACAAGGG + Intergenic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1103523201 12:121549820-121549842 CTTGCTTCCCTGCACCACCATGG + Intronic
1104576775 12:129973159-129973181 CTGGCTCCCCAGGCTTCCCAGGG + Intergenic
1104640051 12:130461466-130461488 CTGGTTTCCCAGGAGCAGCAGGG + Intronic
1104640061 12:130461529-130461551 CTGGTTTCCCAGGAGCAGCAGGG + Intronic
1104961770 12:132491491-132491513 CTGTCTCCCCAGGACTGGCATGG + Intronic
1105265318 13:18809828-18809850 CTGCATCCCCAGGACCACCATGG - Intergenic
1105521638 13:21136367-21136389 CTGGCTTCCCACAACAAGCATGG + Intergenic
1106514340 13:30440129-30440151 CTGGCTTTCCAGGACTGTCATGG + Intergenic
1106553258 13:30789344-30789366 CAGGCTTCCCTGGCCTCCCACGG - Intergenic
1107962318 13:45569553-45569575 CTGGCTTCTTAGGACAGCCAGGG + Intronic
1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG + Intergenic
1112399242 13:99061548-99061570 CTGGCTTCCCCAGTCTGCCATGG - Intronic
1114162747 14:20187491-20187513 CTCTCTCCCCAGGACAACCATGG - Intergenic
1114958174 14:27849272-27849294 CTGTCTCCCCAGCACCACCAGGG - Intergenic
1115140395 14:30164396-30164418 CTTGCTTATCAGGACTTCCATGG + Intronic
1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG + Intronic
1121783634 14:96638692-96638714 CTGGCATGCCAGGATTGCCACGG - Intergenic
1122072268 14:99212551-99212573 CTGGTCTCCCAGGACAGCCAGGG + Intronic
1122529846 14:102417967-102417989 ATGGTTTCCCTGGACTCCCAAGG - Intronic
1122929859 14:104928223-104928245 CTGGAATCCCAGGACTGCCCCGG + Intronic
1127966225 15:63924743-63924765 CTGGCTGCCCAGGCCAACCCTGG + Intronic
1128009591 15:64280330-64280352 CTGACCACCCAGGACAACCAGGG + Intronic
1129880869 15:79005296-79005318 CTGGCTCCCCAGGGCTCCCCAGG - Intronic
1131843035 15:96458431-96458453 CTGGCTTCCCATCACCAGCAGGG + Intergenic
1133244833 16:4441330-4441352 TGGGCATCCCAGGTCTACCAAGG - Intronic
1133328477 16:4956840-4956862 CAGCCCTCCCAGGACTCCCAGGG - Intronic
1133803636 16:9106054-9106076 CTGGGTTCCCAGGCTTACAAGGG - Intronic
1134232630 16:12440401-12440423 CTGGCTTCCAAGGGCTAGGAGGG - Intronic
1139082593 16:63541273-63541295 CTGGCTTCCCTGGGCCACAATGG - Intergenic
1139294910 16:65892278-65892300 CTGGAGTCTCAGGACTGCCAGGG + Intergenic
1139762740 16:69199895-69199917 CTGTCTTCCCAGTAATAGCATGG - Intronic
1140654071 16:77121894-77121916 TTGGCTTCCCTGGGCTGCCAAGG + Intergenic
1142017557 16:87758596-87758618 TTGGCTTCCCTGGGCTACAATGG + Intronic
1142938977 17:3365318-3365340 CTGGTGACCCAGGACTTCCAGGG + Intergenic
1143055266 17:4157628-4157650 GTGGCTTCCCAGCTCTAACAAGG + Exonic
1143517825 17:7428877-7428899 CTGGGGTCCCAGGACTGCCTAGG - Intergenic
1144530560 17:16034779-16034801 CTGTCTTCCCAGGCCCACCCTGG + Exonic
1144584452 17:16479661-16479683 CTGGCAGCCCAGGAAAACCAAGG - Intronic
1145995416 17:29102253-29102275 CTGGGTTCCCAGGCCTATCTTGG - Intronic
1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147637151 17:41971067-41971089 CAGTGTTCCCAGGACCACCAGGG - Intronic
1148116506 17:45178389-45178411 CTGGCTTCCCTGGCCTCCCCAGG + Intergenic
1148502225 17:48100798-48100820 CTGGCTTTGCAGGACTACGGAGG - Exonic
1151663408 17:75531705-75531727 CTGGCTCCCTAGGAATTCCAAGG + Intronic
1151712485 17:75814683-75814705 CTGGCTTCCATGGAACACCAAGG - Intronic
1152296335 17:79469356-79469378 CTGGATTCCCAGGACTGCATGGG - Intronic
1152417500 17:80172018-80172040 CTGGCTGTCCAGAACTCCCAGGG + Intronic
1152451405 17:80383284-80383306 CTGGATTCCCAGGAATTCCTCGG - Intronic
1152943946 17:83188656-83188678 CTGGCTTCCAAAGACTCACAAGG - Intergenic
1152987716 18:335006-335028 CGGGCTTCCCAGGGGAACCACGG + Exonic
1154197555 18:12277480-12277502 CTCGCTTCCCATGACCCCCAGGG - Intronic
1154423077 18:14251701-14251723 CTGCATCCCCAGGACCACCATGG + Intergenic
1154436732 18:14349407-14349429 TTGGCTTCCCTGGACCACAATGG + Intergenic
1155684695 18:28534338-28534360 GTGGCTTCTCAGGCCCACCATGG - Intergenic
1156007163 18:32455836-32455858 CTTTCTTTCCAGGACTACCTTGG - Intronic
1159257909 18:65972723-65972745 CTGGCCTCTCCTGACTACCAGGG + Intergenic
1160834733 19:1119351-1119373 CGGGCTGCCCAGCACTCCCAGGG - Intronic
1161481736 19:4514114-4514136 CTGGCGTCCCAGGGACACCAGGG + Intronic
1162606183 19:11709871-11709893 CTGCCTTTCCAGCACTGCCATGG + Intergenic
1162953461 19:14085489-14085511 ATGGGTTCCCAGGCCTGCCAGGG + Exonic
1163362253 19:16854270-16854292 CTGACTTCCCAGGGCTCCCTAGG + Intronic
1165067252 19:33236490-33236512 CTGGCTTCCCTGGACCACATTGG - Intergenic
1166318113 19:41999952-41999974 CTGGCTTCCCAGGTCTCCAGTGG - Intronic
1166566780 19:43770315-43770337 CTGGCTCCCAAGGCCTTCCAAGG + Intronic
1167716050 19:51143470-51143492 CGGGCTTCCCTGGAGCACCAGGG - Intronic
1167769464 19:51505310-51505332 CTGGCTTTCCAGGACTGGAAGGG + Intergenic
1202639493 1_KI270706v1_random:69422-69444 CTGCATCCCCAGGACCACCATGG - Intergenic
925517079 2:4694799-4694821 CTGCCTGCCCAGGACTACCAAGG + Intergenic
925626962 2:5850957-5850979 TTAGCTTCTCAGGACTTCCATGG - Intergenic
926127350 2:10279698-10279720 CAGCCTACCCAGGACTTCCACGG + Intergenic
928257007 2:29731486-29731508 CTGTCTTCCCAAGACTTCCTGGG + Intronic
930105367 2:47634965-47634987 CTAGTTTCCAAGGACTCCCAAGG - Intergenic
931190844 2:59998789-59998811 CATGCTTCTCAGGACCACCAAGG + Intergenic
932615332 2:73227807-73227829 CTGGCTTCCCAGGGCTTCCTTGG + Intergenic
933874305 2:86602845-86602867 CTGGGTTCACAGGAGTAGCAGGG - Intronic
934479126 2:94618772-94618794 CTGTCTCCCCAGCACCACCAGGG + Intergenic
934489253 2:94748101-94748123 TTGGCTTCCCTGGACCACAATGG - Intergenic
934494978 2:94788872-94788894 CTGCATCCCCAGGACCACCATGG - Intergenic
938247750 2:129792131-129792153 CTGGCTCTCCAGGACTCCCACGG - Intergenic
939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG + Intronic
939789559 2:146555019-146555041 CTGGCTTCACTGGACAACCCTGG - Intergenic
940772933 2:157858181-157858203 CTGGGTTCTCAGGGCTACCTGGG + Intronic
941714494 2:168749436-168749458 CTGTCTTCTCAGCACTTCCAGGG + Intronic
942220400 2:173763396-173763418 CTGGCAACCCAGGCCTTCCATGG + Intergenic
943523467 2:188985699-188985721 CTGGTATTCCAGGACAACCAGGG + Exonic
943610039 2:190021605-190021627 CTGGCTTCCCAAGAAAAGCATGG - Intronic
944188143 2:196972161-196972183 CTACCTTCCCAGTGCTACCATGG + Intronic
944542632 2:200767935-200767957 CTGTCCTCCCAGGTCTCCCAGGG + Intergenic
945682506 2:212931301-212931323 AAAGCTTCCCAAGACTACCATGG + Intergenic
945833580 2:214812594-214812616 CTGGCTTAACAGGACTAATAAGG - Intergenic
946277987 2:218644903-218644925 ATGGCTTCCCAGCACCACCCTGG - Exonic
947143638 2:227043084-227043106 CTGGCTCCTCTGGACCACCAGGG - Exonic
948660891 2:239505845-239505867 CTGGCTTCCCGGCACTGGCAGGG + Intergenic
1169558740 20:6776135-6776157 GTGGCTCCCAAGGAGTACCAAGG - Intronic
1171369286 20:24650786-24650808 CTGGCTCCCAAGGGCTCCCAAGG + Intronic
1171885967 20:30652648-30652670 CTGCATCCCCAGGACCACCATGG - Intergenic
1171886161 20:30653778-30653800 CTGCATCCCCAGGACCACCATGG - Intergenic
1172969134 20:38860896-38860918 CTTGCTTCCCAGTGCTCCCAGGG + Intronic
1173453712 20:43188135-43188157 CTGGATCCCCAGGACTGCCCCGG + Intronic
1175334091 20:58183940-58183962 GTGGCTGCCCTGGACTCCCAGGG - Intergenic
1175550374 20:59813688-59813710 CCGCCTTCCCAGGACTACCCTGG + Intronic
1176647823 21:9367021-9367043 CTGCATCCCCAGGACCACCATGG - Intergenic
1176840306 21:13836247-13836269 TTGGCTTCCCTGGACCACAACGG - Intergenic
1177948831 21:27507953-27507975 CTATCTTCCTAGGCCTACCAAGG + Intergenic
1179548886 21:42130751-42130773 CTGGCTTCCCAGGACACCATGGG + Intronic
1180362449 22:11912448-11912470 CTGCATCCCCAGGACCACCATGG + Intergenic
1180982581 22:19885764-19885786 TTGGCTTCCCAGGACCAGCCAGG - Intronic
1183403820 22:37620138-37620160 CTGCCTCCCCAGGACTCCCCGGG - Intronic
1184463949 22:44658328-44658350 TGGGCCTCCCAGGACTACCCTGG - Intergenic
1185049317 22:48545612-48545634 CTGTCTGCCCAGGAATAGCAGGG - Intronic
950445476 3:13035031-13035053 CTGACATCCCAGCACTGCCAAGG + Intronic
950491727 3:13309348-13309370 ATGGCTTCCCTGGACCACCCAGG + Intergenic
950713580 3:14831568-14831590 CTTGGTTCCCTGGACTAGCATGG - Intronic
951068018 3:18290208-18290230 GTGGCTTACCAGAACTACAAAGG + Intronic
951520942 3:23610184-23610206 TTGGCCCCCCAGGACAACCAGGG - Intergenic
953805263 3:46062703-46062725 CTGGCTTCTCAAGCCTAACATGG + Intergenic
953923821 3:46970357-46970379 CTGGCTTCCCTGGGCCACAATGG - Intronic
954136275 3:48583571-48583593 CAGGCCTCCCAGGACAACCTGGG - Exonic
954290819 3:49649116-49649138 CTGGCATCCTAGGGCCACCATGG - Intronic
959973850 3:112436802-112436824 CTGCCCACCCAGGACTAGCAGGG + Intergenic
960315815 3:116175525-116175547 CTGGCTTCCCAGCACTGCTCTGG - Intronic
961490462 3:127253788-127253810 ATGGCTTCCCAGGGCTCTCAGGG + Intergenic
966521252 3:180875736-180875758 CTGGCTGCCTAAGAATACCAGGG - Intronic
967249075 3:187518618-187518640 CTGCCTTCCTAAGACCACCAAGG + Intergenic
1202739061 3_GL000221v1_random:37966-37988 CTGCATCCCCAGGACCACCATGG + Intergenic
968826074 4:2898244-2898266 GTGGCTTATCATGACTACCATGG + Exonic
969339157 4:6529556-6529578 GTGGCTTTCCAGCACTTCCATGG - Intronic
969483637 4:7459792-7459814 CTGGCTTCACAGGACCCTCAAGG - Intronic
970373797 4:15435853-15435875 CTGGCTTGCCTGGACCTCCAGGG + Exonic
970552589 4:17197505-17197527 CTGACTTGCCAGGACTGCCTTGG + Intergenic
970627740 4:17907791-17907813 TTGGCTTCCCCGGGCTACAATGG - Intronic
970911034 4:21275869-21275891 TTGGCTTCCCTGGACCACAATGG + Intronic
971494393 4:27248641-27248663 CTTGCTTCCCTTGACTTCCAGGG + Intergenic
973391283 4:49559637-49559659 CTGCATCCCCAGGACCACCATGG + Intergenic
977907437 4:102494138-102494160 CTGGCTTGCTAGTACTACTAGGG - Intergenic
980000697 4:127484391-127484413 CTGACTTCCCAGAAATACCCTGG + Intergenic
980093810 4:128468976-128468998 CAGCCTTCCCAGTACAACCATGG + Intergenic
982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG + Intronic
982721373 4:158863472-158863494 ATGGCTGCTCAGCACTACCAGGG + Intronic
985281043 4:188285563-188285585 CTGGCTTCCCTGGGCCACAATGG - Intergenic
1202766853 4_GL000008v2_random:155277-155299 CTGCATCCCCAGGACCACCATGG - Intergenic
986237986 5:5929850-5929872 CTGGCTTCTCAGGAATACAGAGG + Intergenic
987899285 5:23990034-23990056 CTGGATTCCCAGGAATACTTAGG + Intronic
988528400 5:32006618-32006640 CTGCCTACCTAGGACTCCCAAGG + Intronic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
991413221 5:66365863-66365885 CTGGCATCCCAAGATAACCAGGG - Intergenic
1000378176 5:160603511-160603533 CTGGCTTCCCTGGGCCACAATGG - Intronic
1001055468 5:168445762-168445784 CTGGATTCCCAGTAACACCATGG - Intronic
1001892815 5:175353296-175353318 CTGGCTTCCCAGTCCTCCCAGGG - Intergenic
1003867395 6:10375834-10375856 CTGGCTCCTTAGGACTACCCAGG + Intergenic
1006460254 6:34153961-34153983 CTGGCCTCCCAGGAATACAGGGG - Intronic
1007695336 6:43728817-43728839 CTGTCTTACCAGGATTTCCAGGG - Intergenic
1009030790 6:58055917-58055939 CTGGCTTCCCTGGACTTACAAGG + Intergenic
1009760125 6:67994757-67994779 CGGTCATCCCTGGACTACCAAGG - Intergenic
1010089669 6:71965812-71965834 CTGACTTCCCAGAATTACCACGG - Intronic
1012278720 6:97303363-97303385 CAGGCTTCTCAGAACTGCCAAGG - Intergenic
1014415900 6:121184200-121184222 CTGGCTTGCTAGGACAATCAAGG - Intronic
1014729170 6:125010862-125010884 CAGCCCTCCCAGGTCTACCACGG + Intronic
1018724491 6:166600323-166600345 CTGGCTTCCCAAGTGGACCATGG + Intronic
1019654792 7:2185690-2185712 CTAGCTTCCCAGGATTAAAATGG - Intronic
1019947850 7:4344270-4344292 CTGGCGTCCCAGAACAACCCTGG - Intergenic
1021182054 7:17518370-17518392 CTGCCTTCCCGGTAGTACCAAGG - Intergenic
1023275869 7:38518011-38518033 CTCACTGCCCAGGACAACCAAGG + Intronic
1023329975 7:39104520-39104542 CTGGGTTCCCAGGGCAAGCATGG + Intronic
1024256098 7:47540989-47541011 GTGTCCTCCCAGGACTGCCAGGG - Intronic
1025850012 7:65237617-65237639 CTGCCCTCCCAGGCCTCCCAGGG + Intergenic
1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG + Intergenic
1026622873 7:71965979-71966001 CTGCCCTCCAAGTACTACCAGGG + Intronic
1027995703 7:85423539-85423561 GTGGCTTCCCAGGACCCCAAGGG - Intergenic
1029130046 7:98322856-98322878 CTGGTTTCCCTGGAACACCATGG - Intronic
1033286794 7:140048283-140048305 CTGGCTGCCCAGGAGGAACATGG - Intronic
1034410883 7:150941552-150941574 CTGTCTTCCCAGCCCTAGCATGG - Intergenic
1036149194 8:6282344-6282366 CTGGCTTCCCTGGACCACATTGG + Intergenic
1036827313 8:11987373-11987395 CTGGCTCCCAGGGACTTCCAGGG + Intergenic
1037783433 8:21886957-21886979 TTGGCTTCCCAGGTTTGCCATGG - Intergenic
1038758157 8:30361076-30361098 CTGGCTGCAGAGGAGTACCAGGG + Intergenic
1044721976 8:95159818-95159840 CTGGCTTGCCCGCACTGCCATGG + Intergenic
1048844573 8:138594502-138594524 CTGGGATCCCAGGACAGCCACGG + Intronic
1050332060 9:4555605-4555627 CTGACTTCCAAGGACAACCGGGG + Intronic
1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG + Intergenic
1053662148 9:40291482-40291504 CTGCATCCCCAGGACCACCATGG + Intronic
1053678702 9:40464793-40464815 CTGTCTCCCCAGCACCACCAGGG - Intergenic
1053912594 9:42921650-42921672 CTGCATCCCCAGGACCACCATGG + Intergenic
1053928687 9:43093146-43093168 CTGTCTCCCCAGCACCACCAGGG - Intergenic
1054285021 9:63160149-63160171 CTGTCTCCCCAGCACCACCAGGG + Intergenic
1054291780 9:63300331-63300353 CTGTCTCCCCAGCACCACCAGGG - Intergenic
1054374274 9:64437723-64437745 CTGCATCCCCAGGACCACCATGG + Intergenic
1054389798 9:64604874-64604896 CTGTCTCCCCAGCACCACCAGGG - Intergenic
1054505916 9:65911502-65911524 CTGTCTCCCCAGCACCACCAGGG + Intergenic
1054522462 9:66084802-66084824 CTGCATCCCCAGGACCACCATGG - Intergenic
1056373811 9:85986906-85986928 TTGGCTTCCCAGGGCCACCCTGG + Intronic
1056831357 9:89919666-89919688 CTGGCTGCCTAGGAAAACCACGG - Intergenic
1057724819 9:97561041-97561063 CTGGCTTCACAGGCCTTCCCTGG - Intronic
1058041521 9:100307344-100307366 ATGGCTACTCAGCACTACCACGG - Intronic
1060587419 9:124795222-124795244 CTGGCTTCCCATGGTCACCAGGG - Intronic
1061842224 9:133365492-133365514 TTGGCTTCCCTGGGCTACCCTGG + Intronic
1062129133 9:134883315-134883337 CTGCCTTCCCAGGAGGTCCAGGG - Exonic
1062675641 9:137741966-137741988 TAGGATTCCCAGGGCTACCAAGG + Intronic
1203447787 Un_GL000219v1:76085-76107 CTGGCTTCCCAACACTAGCTTGG - Intergenic
1203547602 Un_KI270743v1:140154-140176 CTGCATCCCCAGGACCACCATGG - Intergenic
1186493412 X:9992868-9992890 CTGGCCTCCCCGGACTGCCCCGG - Intergenic
1189472255 X:41323123-41323145 CTAGCTACCCTGGACTACCAGGG - Intergenic
1189713980 X:43845609-43845631 CTGTCTTCCCCGGACCCCCATGG + Intronic
1193421905 X:81292836-81292858 TTGGCTTCCCTGGACCACAATGG + Intronic
1198706870 X:139459120-139459142 CTGTATTCACAGGACTACCATGG + Intergenic