ID: 1121404782

View in Genome Browser
Species Human (GRCh38)
Location 14:93713036-93713058
Sequence CCAGCTTCTGCACTGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121404782_1121404790 1 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404790 14:93713060-93713082 CTCCCATGCTGGGCTCGGGTGGG No data
1121404782_1121404785 -10 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404785 14:93713049-93713071 CAGAAGCTGGGCTCCCATGCTGG No data
1121404782_1121404793 3 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404793 14:93713062-93713084 CCCATGCTGGGCTCGGGTGGGGG No data
1121404782_1121404798 18 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404798 14:93713077-93713099 GGTGGGGGAGGCAGGTGGAGAGG No data
1121404782_1121404796 10 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404796 14:93713069-93713091 TGGGCTCGGGTGGGGGAGGCAGG No data
1121404782_1121404797 13 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404797 14:93713072-93713094 GCTCGGGTGGGGGAGGCAGGTGG No data
1121404782_1121404791 2 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404791 14:93713061-93713083 TCCCATGCTGGGCTCGGGTGGGG No data
1121404782_1121404789 0 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404789 14:93713059-93713081 GCTCCCATGCTGGGCTCGGGTGG No data
1121404782_1121404786 -9 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404786 14:93713050-93713072 AGAAGCTGGGCTCCCATGCTGGG No data
1121404782_1121404799 30 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404799 14:93713089-93713111 AGGTGGAGAGGAACCCAGACAGG No data
1121404782_1121404795 6 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404795 14:93713065-93713087 ATGCTGGGCTCGGGTGGGGGAGG No data
1121404782_1121404787 -4 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404787 14:93713055-93713077 CTGGGCTCCCATGCTGGGCTCGG No data
1121404782_1121404788 -3 Left 1121404782 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG No data
Right 1121404788 14:93713056-93713078 TGGGCTCCCATGCTGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121404782 Original CRISPR CCAGCTTCTGCACTGCAAGC TGG (reversed) Intergenic
No off target data available for this crispr