ID: 1121409487

View in Genome Browser
Species Human (GRCh38)
Location 14:93739655-93739677
Sequence CAGCTGGATTAGGAGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121409487 Original CRISPR CAGCTGGATTAGGAGATCCA GGG Intronic
903328651 1:22585859-22585881 CAGCTGAGTTAGAAGAGCCAGGG - Intronic
904019321 1:27450397-27450419 AAGCTGGTTTGGGAGATTCAGGG - Intronic
904306509 1:29593477-29593499 CAGCTAGAATACGAGCTCCATGG - Intergenic
904709251 1:32416174-32416196 CAGCAGGCTTATGAGGTCCACGG - Intergenic
907470464 1:54670552-54670574 CAGCTGGGTCAGGATCTCCATGG - Exonic
907889335 1:58622618-58622640 AAGGTGGATTAAGAGATACATGG + Intergenic
909554910 1:76942736-76942758 CAGCTGGATGAGGTCATCTATGG + Intronic
913529578 1:119724260-119724282 CCGCTGGTTTAGGGAATCCATGG - Intronic
915565565 1:156710914-156710936 CAGCTCTCTTAGGAGTTCCAGGG + Intergenic
917607128 1:176643677-176643699 CAGCTGGAATAGAATATCCATGG + Intronic
917634353 1:176920399-176920421 CAGCTAGATTAGGCCATCCCCGG - Intronic
920686955 1:208116845-208116867 CATCTGGGTCAGGGGATCCAGGG - Intronic
921819932 1:219605624-219605646 CAGGAGGATTGGGAAATCCATGG - Intergenic
922216845 1:223526717-223526739 CAGCTGGCAAAAGAGATCCAGGG + Intergenic
922217550 1:223532667-223532689 AAGCTGGATTGGGAGGGCCAGGG - Intergenic
924497280 1:244602606-244602628 CAGCTGGATTCAGAGTCCCAGGG + Intronic
1064121334 10:12622624-12622646 CAGCTGGATTTTGAGCCCCATGG + Intronic
1065740084 10:28789704-28789726 CAGCTGGCTGAAGAAATCCAAGG + Intergenic
1065965219 10:30765487-30765509 CAGCTGGATTATGTGTTCAAAGG - Intergenic
1066123800 10:32318998-32319020 TAGGTGGATTAGGAAATTCAGGG - Intronic
1068791267 10:61033895-61033917 CAGCTCGATTAGGAGAACCCAGG + Intergenic
1068792041 10:61039360-61039382 CAGCTCGATTAGGAGAACCCAGG + Intergenic
1069184902 10:65410430-65410452 CAGCTGGATTGATAGATCTATGG + Intergenic
1070703303 10:78618898-78618920 CAGCTGGGGTAGGAGACCCCAGG - Intergenic
1070731425 10:78831259-78831281 CAGCTGGAGCAGAAGATCCTGGG + Intergenic
1075821941 10:125322214-125322236 CAGCTAGATTATAAGCTCCAAGG - Intergenic
1077846126 11:6026856-6026878 CAGCAGGATCAGGATGTCCATGG + Exonic
1078545492 11:12244043-12244065 CAGCTGGATCAGGAGACGGAAGG - Exonic
1078933258 11:15929514-15929536 CATCTGGATTAGGACAGCCCTGG + Intergenic
1079487309 11:20948727-20948749 TAGATGAATTAGGAGATCCTAGG + Intronic
1081842111 11:46210017-46210039 CAGGGGGATAAGGAGATTCAGGG + Intergenic
1086048031 11:82555983-82556005 TAGCAGGATTTGGAGATCCTTGG + Intergenic
1087303651 11:96463930-96463952 CAGCTTGATTAGGAACTCCAAGG + Intronic
1092903459 12:13081505-13081527 CAGCAGGATAAGGACATCAAAGG - Exonic
1093546683 12:20356956-20356978 CAGCAGAATTAGCAGTTCCAGGG + Intergenic
1094414374 12:30201797-30201819 CAGCTGGAGTGGGAGAGGCAGGG - Intergenic
1097249416 12:57624426-57624448 CTGCTGGGTAAAGAGATCCAGGG - Intronic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1104219112 12:126764942-126764964 TAGCTGAATAAGGAGATCAATGG + Intergenic
1106020033 13:25905699-25905721 CAGCTGGCAGAGGAGAACCAGGG - Intronic
1107117955 13:36767282-36767304 CAGCTGAATGAGGAGATGCGAGG + Intergenic
1107784630 13:43942592-43942614 CTGCTGGATTAGCAGAGCAAAGG + Intergenic
1108528720 13:51308651-51308673 GAGCAGACTTAGGAGATCCATGG - Intergenic
1109853466 13:68099676-68099698 CAGCTGAGTGAGGAGATACAAGG + Intergenic
1110790655 13:79583096-79583118 CAGCTGAAATAGCACATCCATGG - Intergenic
1112259949 13:97868869-97868891 CAGCAGGAGTAGGAGGTGCAAGG + Intergenic
1112778582 13:102872291-102872313 CAGCTGGGTTAGGAAAGCCAGGG - Exonic
1116629759 14:47315198-47315220 CATCTGGATTAAGAGAACCAGGG - Intronic
1117028253 14:51643527-51643549 AAGCTGGATTAGAAGGTCAAAGG + Intronic
1119170221 14:72529292-72529314 CAGCAGTAATAGCAGATCCAAGG - Intronic
1120702822 14:87716522-87716544 CAGATGCATTAGGAGGTCCTGGG - Intergenic
1121409487 14:93739655-93739677 CAGCTGGATTAGGAGATCCAGGG + Intronic
1127273400 15:57421434-57421456 CTCCTGGCTTAGGAGATCCTGGG + Intronic
1127284994 15:57524615-57524637 CAGCTGGTTCTGGAGCTCCAGGG - Exonic
1127587699 15:60394392-60394414 CAGCTGGATTAAAAGCTTCAGGG + Intronic
1127926560 15:63549704-63549726 TAGCTAGATTTGAAGATCCAAGG - Intronic
1129776349 15:78239171-78239193 CAGCTGGATTAGGACAAACCTGG + Intronic
1135158302 16:20072903-20072925 CAGCTGGCTAAGGAGAATCAGGG - Intronic
1135611413 16:23870981-23871003 CTGCTGGAAAAGGAGACCCACGG - Intronic
1135690922 16:24537038-24537060 AAGCGGAATTGGGAGATCCAAGG - Intergenic
1137777553 16:51069068-51069090 CAACTGTATTAGGAGAGCTAAGG + Intergenic
1138202031 16:55096305-55096327 CATCTGGAGGAGGGGATCCAGGG - Intergenic
1138537765 16:57668760-57668782 CAGCTGGCTTGTGAGATCCTGGG + Intronic
1146215415 17:30975371-30975393 CATCTGGATTAGAAGATGCCAGG + Intronic
1151568632 17:74915010-74915032 CAGCAGGATGAGGGGCTCCATGG - Intergenic
1156212556 18:34961297-34961319 CAATTGGATTAGAACATCCAAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1159655160 18:71024166-71024188 CAGTTGGTTAAAGAGATCCATGG + Intergenic
1160140298 18:76315535-76315557 CAGCTGGAGTAGCAGATTAAGGG - Intergenic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1165027665 19:32973281-32973303 CAGCTGGCGCAGGAGATGCAAGG + Exonic
1168024227 19:53632092-53632114 CATCTGGATTAGAAGATGCCAGG + Exonic
1168100524 19:54138617-54138639 CAGCTGGAACCTGAGATCCAGGG - Intronic
925209955 2:2036986-2037008 CAGGTGTATTGGGAGAACCAAGG - Intronic
925384583 2:3453297-3453319 AAGCTGGGTCAGGAGCTCCATGG - Intronic
926993993 2:18714365-18714387 CAGCTGGTTTTGGAGCACCAGGG + Intergenic
928862066 2:35871015-35871037 CAAATGGATTAAGAGCTCCAAGG + Intergenic
930062573 2:47302564-47302586 CAGCTGGATGACGAGGTCAAGGG + Intergenic
931051531 2:58420293-58420315 CATCTGGGTTAGAGGATCCAAGG - Intergenic
933795434 2:85915645-85915667 CAACTGGACTAGAAGATCTAAGG + Intergenic
934603510 2:95677092-95677114 CAGCAGGATTGGGAGAGACATGG + Intergenic
935592988 2:104857578-104857600 CAGCTGCCTAAAGAGATCCACGG + Exonic
936536898 2:113319319-113319341 CAGCAGGATTGGGAGAGACATGG + Intergenic
937014766 2:118595377-118595399 CAGCTGGATGAGGAAATCCTTGG - Intergenic
940031152 2:149262838-149262860 CAGCTGTATTTGGAGATAAAAGG + Intergenic
941654780 2:168131666-168131688 CAGGTAGATACGGAGATCCAGGG - Intronic
943049104 2:182894244-182894266 CAGCTGGACTAGGTGTGCCATGG - Intergenic
944961250 2:204876673-204876695 AAGCTGGATTAGGAGTGCCTGGG - Intronic
945967619 2:216205696-216205718 CAGCTGGGTTAGGAAAACCATGG + Exonic
948536290 2:238650185-238650207 CAGCTGGCTGAGGGGCTCCAGGG + Intergenic
948694082 2:239724470-239724492 CAGCTGGCTAAGGAGAGACAGGG - Intergenic
1171778517 20:29394823-29394845 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1171820288 20:29830113-29830135 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1171822574 20:29867273-29867295 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1171897552 20:30823040-30823062 CAGCAGGCTGAGGAGATCGAAGG + Intergenic
1172068755 20:32240603-32240625 AAGCTGGTTTAGGAGGTCCTGGG + Intergenic
1172220451 20:33270878-33270900 CTGATGGATGAGAAGATCCAGGG + Intergenic
1172511398 20:35503629-35503651 CAGCTGGAGCAGCAGCTCCAGGG + Exonic
1172590419 20:36113714-36113736 GAGGTGGATTAGGAGTTCCCGGG + Intronic
1172892125 20:38273087-38273109 AAGCTGGATTTGGAGACACAGGG - Intronic
1173059742 20:39650271-39650293 CTGATGGGTTATGAGATCCAGGG - Intergenic
1173077616 20:39834710-39834732 CAATGGGATTGGGAGATCCAAGG - Intergenic
1173161446 20:40655578-40655600 CCCCTGGATGTGGAGATCCAAGG + Intergenic
1174130884 20:48342601-48342623 CAGCTGGATCACGAGCTCCTGGG + Intergenic
1174564093 20:51452311-51452333 CAGCAGGAGGAGGAGAACCAGGG - Intronic
1177597343 21:23262426-23262448 CAGCTGAATTGGGAGATCTGTGG + Intergenic
1178437740 21:32574903-32574925 CTGATGGATCAGGAGATTCACGG + Intergenic
1180324292 22:11354817-11354839 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1181951341 22:26555981-26556003 CAGATGGTTGAAGAGATCCATGG - Intronic
1181992084 22:26845049-26845071 AGGCTGGACTAGGAGTTCCAAGG + Intergenic
1182361056 22:29746778-29746800 CAGCTGGATGCTGGGATCCAGGG - Intronic
952023968 3:29056715-29056737 CAGCTGCTTTGAGAGATCCATGG + Intergenic
952817118 3:37455204-37455226 AAGCAGGACTAGAAGATCCAGGG - Intronic
956921249 3:73931775-73931797 CAGCTGGATCATCAGCTCCAAGG + Intergenic
957086637 3:75685732-75685754 CAGCAGGCTGAGGAGATCCAAGG + Intergenic
959377283 3:105602406-105602428 CAGCTGGATTCATAGAACCACGG - Intergenic
960148798 3:114231175-114231197 AAGCTGGACTGGGAGAACCAAGG + Intergenic
962807656 3:138938686-138938708 CAGCTGGAACAGGCGATGCACGG + Intergenic
963844107 3:150137489-150137511 AAGCTGAATTATGATATCCAAGG + Intergenic
964919613 3:161880462-161880484 CAGCTTGATCAGGAGATTAAAGG + Intergenic
970695182 4:18668572-18668594 AAGCTGTATTAGGAGACCCTGGG - Intergenic
972115094 4:35621725-35621747 CACCTGGCTTTGGAGATGCAAGG - Intergenic
975189261 4:71440596-71440618 CAGCTGCATGAGAAGAACCAAGG - Exonic
975919782 4:79371331-79371353 AAGCTGGGCTAGAAGATCCAAGG - Intergenic
978347776 4:107789146-107789168 CAGCTGCAGCAGGAGATGCATGG - Intergenic
982906553 4:161082220-161082242 CAGCTGGTTTATGTCATCCAAGG + Intergenic
982906567 4:161082332-161082354 CAGCTGGTTTATGTCATCCAAGG + Intergenic
983123590 4:163920239-163920261 CAGCTGGAATAGGGGATTTATGG - Intronic
983747552 4:171220673-171220695 CAGCTGGATTCTGAGATGCTCGG - Intergenic
983761191 4:171408476-171408498 CAGCTGAACTAACAGATCCATGG + Intergenic
986431404 5:7684642-7684664 CAGCTGGATTTGCAGGTTCAAGG - Intronic
989534912 5:42552100-42552122 CAACTGGTTTAGGAGAAACATGG + Intronic
995454872 5:112340325-112340347 CAGCTGAATTAGGAGCTCCGGGG - Intronic
995559009 5:113360894-113360916 TAGCAGGAGTAGGACATCCAGGG - Intronic
996377902 5:122834015-122834037 CAACTAAACTAGGAGATCCAGGG + Intergenic
1000295087 5:159906520-159906542 CTGCTGAATTAGGATATCTAAGG + Intergenic
1001773560 5:174312607-174312629 CAGCACCATTAGGAAATCCATGG + Intergenic
1002914425 6:1517557-1517579 CAGCTAGATACGGAGATCCAGGG - Intergenic
1006600682 6:35223540-35223562 CAGCTGAATCAGGATCTCCAGGG - Intronic
1006632411 6:35438854-35438876 CAGGTGGCTTGAGAGATCCAAGG - Intergenic
1007304957 6:40896682-40896704 CAGCTTGAGGAGGAGATCAAAGG - Intergenic
1014929449 6:127317247-127317269 TAGCTGGATAAGAAGAGCCAAGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018286571 6:162246170-162246192 CAGTTGGATTAGGAGGTGCTGGG - Intronic
1018795286 6:167180373-167180395 CTGATGGATCAGGAGATTCACGG - Intronic
1018956153 6:168411857-168411879 CAGGTGGATTAGGACAGCGAGGG + Intergenic
1018981637 6:168606186-168606208 CAGCTGCATTAGGAGACACCTGG + Intronic
1022105766 7:27196382-27196404 TAGCTGGATTAGTAGATCAAGGG - Exonic
1022525423 7:31034028-31034050 AAGCTGGAATGGCAGATCCAAGG - Intergenic
1024195382 7:47053483-47053505 GAGCTGGATTTGGAGATTGATGG - Intergenic
1029243548 7:99181982-99182004 GAGCTGGATCAGCTGATCCATGG + Exonic
1029486388 7:100844968-100844990 GAGCTGTAATAGGAGATCAATGG + Intronic
1030099207 7:105930228-105930250 CTGTTGGATTTGGAGGTCCAAGG - Intronic
1031276741 7:119733758-119733780 CTTCTGGATTATGAGATACAAGG + Intergenic
1031633576 7:124074131-124074153 CAGCTGGAGGAGGAGAGCCTAGG - Intergenic
1032131043 7:129227884-129227906 CAGCTGGATGACGAAATTCAGGG + Intronic
1033682257 7:143606110-143606132 CAATTGGATAAGGAGATCCAAGG - Intergenic
1033702632 7:143855803-143855825 CAATTGGATAAGGAGATCCAAGG + Intronic
1034128148 7:148692396-148692418 CAGTTGGATGAGGAAATGCATGG + Intergenic
1035048487 7:155984438-155984460 CAGCTGGAGTGGGACAGCCAGGG - Intergenic
1035428064 7:158795322-158795344 CAGCTGAATAAGGAAATCCTTGG - Intronic
1038125500 8:24668811-24668833 CATTTGGATTTGGAGATCCTCGG - Intergenic
1039289395 8:36077578-36077600 CAGCTGGCTCAGGAGAGCCTGGG - Intergenic
1044057574 8:87590246-87590268 CAGTTGGGTCAGGAGACCCAGGG - Intronic
1047816082 8:128464549-128464571 CAGCTGCATTTGGAGAGGCAAGG - Intergenic
1049233392 8:141495802-141495824 CAGGTGGATTAGTAGATGGAAGG - Intergenic
1052047258 9:23808868-23808890 CAGAAGCATTAAGAGATCCAGGG - Intronic
1052178488 9:25495454-25495476 CAGGTGGATCAAGAGATCAAGGG - Intergenic
1054335695 9:63806416-63806438 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1057871969 9:98725254-98725276 CAGCTGGGTTTGGAGATCTCTGG - Intergenic
1058030960 9:100197269-100197291 CAGCTGGTTGAAGAGATACATGG + Intronic
1062161976 9:135085697-135085719 CATTTGGATTAGGGGATCCATGG - Intronic
1203371948 Un_KI270442v1:315389-315411 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1203375633 Un_KI270442v1:373898-373920 CAGCAGGCTGAGGAGATCCAAGG - Intergenic
1190844367 X:54177883-54177905 GAGCTGAATTATGAAATCCAAGG + Intronic
1195300192 X:103522126-103522148 AAGATGGATTAGTAGATCAAAGG + Intergenic
1196104437 X:111881401-111881423 CAGGTGGATCATGAGATCAAGGG - Intronic
1198742786 X:139858459-139858481 CATGTGGATTAGGAAACCCAGGG - Intronic
1201066401 Y:10099737-10099759 CAGCAGTCTGAGGAGATCCAAGG + Intergenic
1201761489 Y:17544157-17544179 TAGCAGGCTGAGGAGATCCAAGG - Intergenic
1201840063 Y:18361833-18361855 TAGCAGGCTGAGGAGATCCAAGG + Intergenic