ID: 1121412726

View in Genome Browser
Species Human (GRCh38)
Location 14:93759193-93759215
Sequence GTTGCTCAGCGGGTCTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121412726 Original CRISPR GTTGCTCAGCGGGTCTCTAT TGG Intronic
1073516667 10:104082024-104082046 GTTGATCAGCTGGTCTCATTTGG - Intronic
1074363524 10:112840601-112840623 GCTGCCCAGGGGGTCTCAATGGG - Intergenic
1079340741 11:19609820-19609842 GTTGCTCAGTGGGTCCATATTGG + Intronic
1080227976 11:29982372-29982394 TTTTCTCAGAGGATCTCTATAGG - Intergenic
1080927803 11:36776518-36776540 GTTGCTCAGCTAGTCAATATTGG + Intergenic
1091963670 12:4720417-4720439 GTTGCTCAGCGGCTTTCCACAGG - Exonic
1098962664 12:76755077-76755099 GGTGCTCAGGGGGTCCCTTTGGG + Intergenic
1102076280 12:110062836-110062858 GTTGCTCAGCTGTTCTCAACTGG + Intronic
1104618830 12:130294200-130294222 GTTGCCCAGCTGGTCTCGAGGGG + Intergenic
1110607633 13:77451163-77451185 GTTGCCTAGCTGGACTCTATGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1121412726 14:93759193-93759215 GTTGCTCAGCGGGTCTCTATTGG + Intronic
1127655154 15:61048696-61048718 ATTGTTCAGGGGGACTCTATGGG - Intronic
1133923257 16:10173376-10173398 GTTACTCAGCAGTTCTCTACAGG + Intronic
1138400023 16:56738159-56738181 GTTGCTCAGGTGATCTCTAAGGG - Intronic
1139289648 16:65845840-65845862 TTTGCTCAGCAGGCCTCTTTCGG - Intergenic
1142353101 16:89588697-89588719 GCTGTTCCGCGGGTCTCCATTGG - Exonic
1143367497 17:6417745-6417767 GTTGCTCTGAGAGTCTCTCTCGG - Intronic
1146846870 17:36187747-36187769 GTGGCTCAGGGGGTCTCTTCAGG + Intronic
1154194198 18:12254109-12254131 GATGCTCCCCGGGTCTCTTTTGG - Intergenic
1159430118 18:68340786-68340808 ATTGCTCAGCAGGTGTCTTTGGG - Intergenic
1162553428 19:11371469-11371491 GATGCTCAGTGGGTCTTTATAGG + Intergenic
1166142249 19:40811403-40811425 GGTGCTCAGCGGGTGCCCATAGG + Intronic
1166185274 19:41135391-41135413 GGTGCTCAGCGGGTGCCCATAGG - Intergenic
933165963 2:79075195-79075217 GTTGCTGAGCAGATCCCTATAGG - Intergenic
933841784 2:86292776-86292798 GGTGGTCAGCGGGTATCTGTGGG + Intronic
939288890 2:140167938-140167960 TTTGCTCAGGAGCTCTCTATTGG - Intergenic
942703645 2:178742626-178742648 CTTGCTCAGTGGTTCTGTATAGG - Intronic
1179664719 21:42903032-42903054 GTTGCTTGGTGGGTTTCTATGGG + Intronic
954966543 3:54616419-54616441 GTTGCTCGTCTGATCTCTATTGG - Intronic
955703196 3:61702572-61702594 GTGGCTCAGTGTGTTTCTATAGG + Intronic
972702013 4:41503445-41503467 GTCCCTCAGCGGGCCTGTATTGG - Intronic
976293842 4:83449804-83449826 GATGCTCAGCTGTTCTCTACTGG + Intronic
977058316 4:92221540-92221562 GTAGCTCAGCACGCCTCTATTGG - Intergenic
994968075 5:106699471-106699493 TTTGCCCAGTGGGTCTATATGGG - Intergenic
997474002 5:134132395-134132417 GATGCTCAGCTGGTCGCTATTGG - Intronic
998445874 5:142198014-142198036 GTTGCTCAAGGGGTCTCTGCTGG + Intergenic
999875752 5:155803919-155803941 GTTTCTCAATGGGTCACTATTGG - Intergenic
1009617735 6:66032179-66032201 GGTGCTCAGAGGTTCTCTGTTGG - Intergenic
1018088712 6:160327266-160327288 GTTGCTAAGCTGGTCACTCTAGG - Intergenic
1020816603 7:12913208-12913230 GTTGACCAGTGGGTCACTATGGG + Intergenic
1022671669 7:32461774-32461796 GTTTCTCAGAGGGTCTCCAGTGG - Intergenic
1045836239 8:106524869-106524891 GATGCTCAGAGGGCCTTTATGGG + Intronic
1056714279 9:89015151-89015173 GTTACTCAGGGGGTCTTTCTGGG - Intronic
1186965346 X:14781108-14781130 GTTTCTCAGAGAGTCTCTAGTGG - Intergenic