ID: 1121419897

View in Genome Browser
Species Human (GRCh38)
Location 14:93805900-93805922
Sequence CTCCCGTCCTGTTCCATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121419890_1121419897 7 Left 1121419890 14:93805870-93805892 CCTGTCTCATTTAGAGTCCCCTC No data
Right 1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG No data
1121419893_1121419897 -10 Left 1121419893 14:93805887-93805909 CCCCTCTTCTGGGCTCCCGTCCT No data
Right 1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG No data
1121419887_1121419897 15 Left 1121419887 14:93805862-93805884 CCTGGACCCCTGTCTCATTTAGA No data
Right 1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG No data
1121419889_1121419897 8 Left 1121419889 14:93805869-93805891 CCCTGTCTCATTTAGAGTCCCCT No data
Right 1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG No data
1121419888_1121419897 9 Left 1121419888 14:93805868-93805890 CCCCTGTCTCATTTAGAGTCCCC No data
Right 1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121419897 Original CRISPR CTCCCGTCCTGTTCCATCCT GGG Intergenic