ID: 1121421472

View in Genome Browser
Species Human (GRCh38)
Location 14:93818716-93818738
Sequence CATCTGGGTGTCACTGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121421472_1121421477 5 Left 1121421472 14:93818716-93818738 CCTATGCCAGTGACACCCAGATG No data
Right 1121421477 14:93818744-93818766 CTCCTCTCAACCCCAGCTCCAGG No data
1121421472_1121421479 10 Left 1121421472 14:93818716-93818738 CCTATGCCAGTGACACCCAGATG No data
Right 1121421479 14:93818749-93818771 CTCAACCCCAGCTCCAGGCTTGG No data
1121421472_1121421484 30 Left 1121421472 14:93818716-93818738 CCTATGCCAGTGACACCCAGATG No data
Right 1121421484 14:93818769-93818791 TGGTTATTCCCCCAACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121421472 Original CRISPR CATCTGGGTGTCACTGGCAT AGG (reversed) Intergenic
No off target data available for this crispr