ID: 1121427407

View in Genome Browser
Species Human (GRCh38)
Location 14:93862347-93862369
Sequence ATCTCCTTCTAGAGAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121427402_1121427407 12 Left 1121427402 14:93862312-93862334 CCATTAACCATGGAGAGGCAAAA No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data
1121427398_1121427407 21 Left 1121427398 14:93862303-93862325 CCCAGGCCTCCATTAACCATGGA No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data
1121427396_1121427407 22 Left 1121427396 14:93862302-93862324 CCCCAGGCCTCCATTAACCATGG No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data
1121427399_1121427407 20 Left 1121427399 14:93862304-93862326 CCAGGCCTCCATTAACCATGGAG No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data
1121427401_1121427407 15 Left 1121427401 14:93862309-93862331 CCTCCATTAACCATGGAGAGGCA No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data
1121427403_1121427407 5 Left 1121427403 14:93862319-93862341 CCATGGAGAGGCAAAACCTTCTT No data
Right 1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121427407 Original CRISPR ATCTCCTTCTAGAGAGGTGA TGG Intergenic
No off target data available for this crispr