ID: 1121429757

View in Genome Browser
Species Human (GRCh38)
Location 14:93878589-93878611
Sequence CAGCAACTCCTGGACCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121429757_1121429764 1 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429764 14:93878613-93878635 TGGGAGCCTGGCACAGTGCTGGG No data
1121429757_1121429763 0 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429763 14:93878612-93878634 CTGGGAGCCTGGCACAGTGCTGG No data
1121429757_1121429768 10 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429768 14:93878622-93878644 GGCACAGTGCTGGGTCCCTGGGG No data
1121429757_1121429766 8 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429766 14:93878620-93878642 CTGGCACAGTGCTGGGTCCCTGG No data
1121429757_1121429767 9 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429767 14:93878621-93878643 TGGCACAGTGCTGGGTCCCTGGG No data
1121429757_1121429769 19 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121429757 Original CRISPR CAGCAACTCCTGGACCCCCA GGG (reversed) Intergenic
No off target data available for this crispr