ID: 1121429764

View in Genome Browser
Species Human (GRCh38)
Location 14:93878613-93878635
Sequence TGGGAGCCTGGCACAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121429751_1121429764 23 Left 1121429751 14:93878567-93878589 CCTGTGAGGGAGGTGGACGGGAC No data
Right 1121429764 14:93878613-93878635 TGGGAGCCTGGCACAGTGCTGGG No data
1121429758_1121429764 0 Left 1121429758 14:93878590-93878612 CCTGGGGGTCCAGGAGTTGCTGC No data
Right 1121429764 14:93878613-93878635 TGGGAGCCTGGCACAGTGCTGGG No data
1121429757_1121429764 1 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429764 14:93878613-93878635 TGGGAGCCTGGCACAGTGCTGGG No data
1121429761_1121429764 -9 Left 1121429761 14:93878599-93878621 CCAGGAGTTGCTGCTGGGAGCCT No data
Right 1121429764 14:93878613-93878635 TGGGAGCCTGGCACAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121429764 Original CRISPR TGGGAGCCTGGCACAGTGCT GGG Intergenic
No off target data available for this crispr