ID: 1121429765

View in Genome Browser
Species Human (GRCh38)
Location 14:93878619-93878641
Sequence CAGGGACCCAGCACTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121429765_1121429774 6 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429774 14:93878648-93878670 AACAGGAACCTCTACTCTTGGGG No data
1121429765_1121429776 14 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429776 14:93878656-93878678 CCTCTACTCTTGGGGCTGTGAGG No data
1121429765_1121429772 4 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429772 14:93878646-93878668 AAAACAGGAACCTCTACTCTTGG No data
1121429765_1121429777 17 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429777 14:93878659-93878681 CTACTCTTGGGGCTGTGAGGAGG No data
1121429765_1121429773 5 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429773 14:93878647-93878669 AAACAGGAACCTCTACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121429765 Original CRISPR CAGGGACCCAGCACTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr