ID: 1121429768

View in Genome Browser
Species Human (GRCh38)
Location 14:93878622-93878644
Sequence GGCACAGTGCTGGGTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121429761_1121429768 0 Left 1121429761 14:93878599-93878621 CCAGGAGTTGCTGCTGGGAGCCT No data
Right 1121429768 14:93878622-93878644 GGCACAGTGCTGGGTCCCTGGGG No data
1121429758_1121429768 9 Left 1121429758 14:93878590-93878612 CCTGGGGGTCCAGGAGTTGCTGC No data
Right 1121429768 14:93878622-93878644 GGCACAGTGCTGGGTCCCTGGGG No data
1121429757_1121429768 10 Left 1121429757 14:93878589-93878611 CCCTGGGGGTCCAGGAGTTGCTG No data
Right 1121429768 14:93878622-93878644 GGCACAGTGCTGGGTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121429768 Original CRISPR GGCACAGTGCTGGGTCCCTG GGG Intergenic
No off target data available for this crispr