ID: 1121429774

View in Genome Browser
Species Human (GRCh38)
Location 14:93878648-93878670
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121429765_1121429774 6 Left 1121429765 14:93878619-93878641 CCTGGCACAGTGCTGGGTCCCTG No data
Right 1121429774 14:93878648-93878670 AACAGGAACCTCTACTCTTGGGG No data
1121429761_1121429774 26 Left 1121429761 14:93878599-93878621 CCAGGAGTTGCTGCTGGGAGCCT No data
Right 1121429774 14:93878648-93878670 AACAGGAACCTCTACTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121429774 Original CRISPR AACAGGAACCTCTACTCTTG GGG Intergenic
No off target data available for this crispr