ID: 1121431851

View in Genome Browser
Species Human (GRCh38)
Location 14:93893336-93893358
Sequence CAGAAGAGCCCCAACTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121431851_1121431858 10 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431858 14:93893369-93893391 CCGTCTGCTGGTGAAGAGGCTGG No data
1121431851_1121431860 24 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431860 14:93893383-93893405 AGAGGCTGGATTTAATCTCTGGG No data
1121431851_1121431859 23 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431859 14:93893382-93893404 AAGAGGCTGGATTTAATCTCTGG No data
1121431851_1121431861 25 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431861 14:93893384-93893406 GAGGCTGGATTTAATCTCTGGGG No data
1121431851_1121431853 -2 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431853 14:93893357-93893379 TGGACCTGTTTCCCGTCTGCTGG No data
1121431851_1121431855 6 Left 1121431851 14:93893336-93893358 CCAGGCAAGTTGGGGCTCTTCTG No data
Right 1121431855 14:93893365-93893387 TTTCCCGTCTGCTGGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121431851 Original CRISPR CAGAAGAGCCCCAACTTGCC TGG (reversed) Intergenic
No off target data available for this crispr