ID: 1121432453

View in Genome Browser
Species Human (GRCh38)
Location 14:93897717-93897739
Sequence TTTAGCCATCAGGCCACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121432453_1121432460 13 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432460 14:93897753-93897775 GAAAAGCAAGCGTGGAGCTGTGG No data
1121432453_1121432457 -10 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432457 14:93897730-93897752 GATGGCTAAAATAAATGAAGGGG No data
1121432453_1121432459 5 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432459 14:93897745-93897767 TGAAGGGGGAAAAGCAAGCGTGG No data
1121432453_1121432458 -9 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432458 14:93897731-93897753 ATGGCTAAAATAAATGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121432453 Original CRISPR TTTAGCCATCAGGCCACATT AGG (reversed) Intergenic
No off target data available for this crispr