ID: 1121432454

View in Genome Browser
Species Human (GRCh38)
Location 14:93897727-93897749
Sequence CTTCATTTATTTTAGCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121432454_1121432460 3 Left 1121432454 14:93897727-93897749 CCTGATGGCTAAAATAAATGAAG No data
Right 1121432460 14:93897753-93897775 GAAAAGCAAGCGTGGAGCTGTGG No data
1121432454_1121432459 -5 Left 1121432454 14:93897727-93897749 CCTGATGGCTAAAATAAATGAAG No data
Right 1121432459 14:93897745-93897767 TGAAGGGGGAAAAGCAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121432454 Original CRISPR CTTCATTTATTTTAGCCATC AGG (reversed) Intergenic
No off target data available for this crispr