ID: 1121432457

View in Genome Browser
Species Human (GRCh38)
Location 14:93897730-93897752
Sequence GATGGCTAAAATAAATGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121432453_1121432457 -10 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432457 14:93897730-93897752 GATGGCTAAAATAAATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121432457 Original CRISPR GATGGCTAAAATAAATGAAG GGG Intergenic
No off target data available for this crispr