ID: 1121432459

View in Genome Browser
Species Human (GRCh38)
Location 14:93897745-93897767
Sequence TGAAGGGGGAAAAGCAAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121432453_1121432459 5 Left 1121432453 14:93897717-93897739 CCTAATGTGGCCTGATGGCTAAA No data
Right 1121432459 14:93897745-93897767 TGAAGGGGGAAAAGCAAGCGTGG No data
1121432454_1121432459 -5 Left 1121432454 14:93897727-93897749 CCTGATGGCTAAAATAAATGAAG No data
Right 1121432459 14:93897745-93897767 TGAAGGGGGAAAAGCAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121432459 Original CRISPR TGAAGGGGGAAAAGCAAGCG TGG Intergenic
No off target data available for this crispr