ID: 1121432973

View in Genome Browser
Species Human (GRCh38)
Location 14:93900377-93900399
Sequence CAGCAGAAGGAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121432973_1121432980 19 Left 1121432973 14:93900377-93900399 CCTGACTCCATCTCCTTCTGCTG No data
Right 1121432980 14:93900419-93900441 CCCATCTCGCCAGATTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121432973 Original CRISPR CAGCAGAAGGAGATGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr