ID: 1121438862

View in Genome Browser
Species Human (GRCh38)
Location 14:93936333-93936355
Sequence GTCTCTGCAGGGATTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121438862 Original CRISPR GTCTCTGCAGGGATTTCCCT GGG Intronic
900776700 1:4591106-4591128 GGCTCTGCAGGGAATCCCGTTGG - Intergenic
900901589 1:5520092-5520114 GTCTCTGCTGCGATTTACATTGG + Intergenic
901495390 1:9618271-9618293 GCCCCTGCTGGCATTTCCCTGGG - Intergenic
902629187 1:17694797-17694819 ATCCCTGCATGGATTGCCCTTGG + Intronic
903667992 1:25019407-25019429 CACTCTGCAGGGGCTTCCCTGGG + Intergenic
904860879 1:33536842-33536864 GTCTCTGCAGGGTGCTCCCATGG + Intronic
905960491 1:42038529-42038551 GGCTCTGAAGGAATTTCCCAGGG - Intergenic
911244675 1:95503870-95503892 CTCTGTGCAGGGATTTCGGTGGG + Intergenic
916915260 1:169399999-169400021 GTCTGTGTGGGGGTTTCCCTTGG + Intronic
916926307 1:169524502-169524524 CTCTCTGCAGGGATTTGGCAAGG - Intronic
917220386 1:172722300-172722322 GTCTGGGCATTGATTTCCCTAGG + Intergenic
919857104 1:201713470-201713492 GTCTCTGCAGGGAGTGGGCTAGG - Intronic
921083519 1:211764794-211764816 GTATCTGCTGGTATGTCCCTAGG - Intronic
921256704 1:213347937-213347959 GTCTCTGCATTGATGTTCCTGGG - Intergenic
921803673 1:219430636-219430658 GTCTCTGTAGTGATTGCCCTTGG + Intergenic
922963033 1:229664306-229664328 GTTACTGCTGGGATTTCCCGTGG - Intergenic
923957192 1:239035931-239035953 ATGTCTGCATGGATTTCTCTTGG - Intergenic
924348809 1:243095727-243095749 GACTTTGCTGGGATTACCCTAGG - Intergenic
924477657 1:244395691-244395713 GTCTCTGCAAGGCTTGCCCCAGG - Intergenic
1065003379 10:21357358-21357380 CTCTCTGCAGGCATTTCTCTAGG + Intergenic
1065203667 10:23338149-23338171 TTCTCTGTAGGGGATTCCCTTGG - Intronic
1066109044 10:32180186-32180208 GTCTGGGCACTGATTTCCCTAGG - Intergenic
1066503763 10:36020802-36020824 GTCACTGCAGGTATGTCACTTGG + Intergenic
1067279954 10:44863788-44863810 GTCTTTGCACCTATTTCCCTAGG + Intergenic
1068768865 10:60798182-60798204 TTCTCTTTAGGGATTTGCCTTGG - Intergenic
1070130072 10:73649696-73649718 GTCTCTGCAGGGAGGTCTCTGGG - Intronic
1070537392 10:77389918-77389940 GTCTCTGCATGGCTCTCCCATGG - Intronic
1070954648 10:80455686-80455708 GTCTTTCCAGGGATCTTCCTGGG + Intronic
1071181893 10:82995798-82995820 GTCTGTGCAGAGATTTCTCCAGG - Intergenic
1071493789 10:86154132-86154154 GTCTGGGCAGGTATTTCCCATGG - Intronic
1077926111 11:6683262-6683284 GTCGCTGCAGCGATCTCCCATGG - Exonic
1079243029 11:18733953-18733975 ATCTGTACAGGAATTTCCCTAGG - Intronic
1080639280 11:34149391-34149413 GCATCTACAGGGATTTCACTCGG - Intergenic
1081653907 11:44844341-44844363 GTCTAGGCAGGCATTTCTCTTGG + Intronic
1083428159 11:62600088-62600110 GTCCCTGCAGGTATTTCCCCTGG - Intronic
1084270084 11:68024310-68024332 GTATCTGCCAGGGTTTCCCTGGG + Intronic
1086225034 11:84497556-84497578 GTTTCCGCAGGGATCTCCTTTGG - Intronic
1087156212 11:94907424-94907446 GTCACTGCTAAGATTTCCCTGGG + Intergenic
1089256239 11:117195796-117195818 GACTCTGCAGGGGTTTTCTTGGG - Exonic
1089623348 11:119735495-119735517 GACTCTGCAGTGATCTCCATAGG - Intergenic
1090016588 11:123091644-123091666 GTCTGGGCACCGATTTCCCTAGG + Intronic
1090763340 11:129855953-129855975 TTCTCGTCAGGGATTTCTCTGGG - Intronic
1090801603 11:130176298-130176320 TTCTCTGCAGGGGGTTCCCTTGG + Intronic
1090986850 11:131774937-131774959 TTCCCTGCAGTGGTTTCCCTAGG + Intronic
1093351555 12:18108833-18108855 GTCTGGGCATTGATTTCCCTAGG - Intronic
1093631402 12:21413639-21413661 GTCTGGGCACTGATTTCCCTAGG - Intronic
1094168173 12:27464019-27464041 GCCTCTGCTGGGATTCCACTGGG - Intergenic
1095188442 12:39228716-39228738 GTCTCTGCTGTGATTTCCTCTGG + Intergenic
1095873446 12:47055330-47055352 GTTTCTTCAGGGCTTACCCTGGG + Intergenic
1098360324 12:69648207-69648229 TTCTCTGGAGGGAGATCCCTAGG + Intronic
1100221330 12:92507250-92507272 TTCCCAGCAGGGATTTCCCAAGG + Intergenic
1101815368 12:108141933-108141955 CTCTTTGCAGGGATTTCAATAGG - Intronic
1102970463 12:117162097-117162119 TGCCCTGCAGGAATTTCCCTGGG - Intronic
1103415709 12:120740457-120740479 GTGCCTGCAGGGCTTTCTCTGGG + Intergenic
1104406973 12:128526008-128526030 CTCTCTGCAGGAATGTCTCTGGG + Intronic
1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG + Intronic
1106047910 13:26162331-26162353 GTCTTTACTGCGATTTCCCTAGG - Intronic
1106486333 13:30176127-30176149 GTCTTTGATGGGATTTCCCTGGG + Intergenic
1108531944 13:51335616-51335638 GACTGTGCGGGAATTTCCCTAGG - Intergenic
1110800355 13:79687050-79687072 GACTCTGCAGAGAATTCCTTTGG - Intergenic
1112578931 13:100662036-100662058 GGCTGTGCTGGGATTTCACTAGG - Intronic
1112898910 13:104335859-104335881 GCCCCTGCAGGGATTCCCATGGG - Intergenic
1114615424 14:24065498-24065520 GTCTCTGCAGGGCTTCCCCGTGG + Intronic
1114965989 14:27960326-27960348 TTCTCTGTATGTATTTCCCTAGG + Intergenic
1115646035 14:35369091-35369113 ATCTCTGCAGCGTTTTCCCCGGG - Intergenic
1116029641 14:39555253-39555275 GTCTGGGCACTGATTTCCCTAGG + Intergenic
1118019188 14:61694066-61694088 TTCTCTTCAGGCATTTCCCATGG + Intergenic
1121438862 14:93936333-93936355 GTCTCTGCAGGGATTTCCCTGGG + Intronic
1122797410 14:104212910-104212932 GCCTCTGGAGGGGGTTCCCTGGG - Intergenic
1202860226 14_GL000225v1_random:77288-77310 ATCTCTGCACTGATCTCCCTTGG + Intergenic
1125715034 15:41814850-41814872 GTTTCTCCAGTGACTTCCCTGGG + Intronic
1125930955 15:43599850-43599872 TTCACTCCAGGGATCTCCCTGGG + Intronic
1125944119 15:43699666-43699688 TTCACTCCAGGGATCTCCCTGGG + Intergenic
1127456296 15:59158984-59159006 GTCTCTGCAGAGATCTCCTCTGG - Intronic
1128242397 15:66109905-66109927 GTCTCTGCGAGGCTTTCCCCAGG - Intronic
1128683615 15:69668249-69668271 TTCCATGCAGGGATGTCCCTGGG - Intergenic
1132676240 16:1122478-1122500 GTTTCTGCAGGGGGTTCCCCGGG + Intergenic
1133979953 16:10625776-10625798 GTGTGTGCAGGGTTTTCCTTTGG - Intergenic
1135886017 16:26308779-26308801 GTCTCTCCACCGAGTTCCCTCGG + Intergenic
1138333740 16:56235567-56235589 CTCTCAGCAGGCATTCCCCTAGG - Intronic
1139064758 16:63298962-63298984 GGCTCACCAGGGGTTTCCCTTGG + Intergenic
1140928484 16:79605527-79605549 GTCTCTGCAGGTTTCTTCCTTGG + Intergenic
1141264492 16:82484050-82484072 GTCTTGGCATGGATTTCCTTGGG - Intergenic
1142892815 17:2956384-2956406 GTCTCTCCAGGGACTTCACCAGG + Intronic
1144350034 17:14386245-14386267 GTCTCTGCATGCATTTCCATGGG - Intergenic
1144398586 17:14871417-14871439 GTCTCCGCAATGATTTCCCAGGG - Intergenic
1144718528 17:17451201-17451223 GTCCCTGCAGGGAATGACCTAGG - Intergenic
1145249346 17:21288842-21288864 GGCTCTGCTGGGATGGCCCTGGG + Intronic
1146419187 17:32666291-32666313 TTCTCTGCAGGCACTTGCCTGGG + Intronic
1146533445 17:33629867-33629889 ATCTCTTTAGGGATTTCCATTGG - Intronic
1147496662 17:40922925-40922947 GTCTGTGCAAGGACTTTCCTTGG + Exonic
1148893793 17:50827965-50827987 GGCTCTGCACGGATGGCCCTAGG + Intergenic
1150645416 17:66974793-66974815 CTCTCTGCAGGCTTTTCCCAGGG + Intronic
1151668652 17:75559503-75559525 TTCTCTGCTGGGAATTCCATGGG + Intronic
1152369265 17:79875859-79875881 GTCTCAGCATGGATTTCTTTGGG + Intergenic
1152788328 17:82263899-82263921 GTCTCTGCTGAGCTTTCCCTGGG + Intronic
1155394449 18:25372204-25372226 GTGTCTGCAGGGAATTCCAGGGG - Intergenic
1156233708 18:35180506-35180528 GTCTCAGCAGCTATTCCCCTAGG + Intergenic
1157796687 18:50581380-50581402 CTCTCTGCAGGTCTTTCCATAGG + Intronic
1158128308 18:54126059-54126081 GTGTCTGCAGGGAGTCCCCAAGG + Intergenic
1162348004 19:10132200-10132222 GTCTTTGCTGGGAGCTCCCTGGG - Intergenic
1162398184 19:10430153-10430175 GGATCTGAAGGGTTTTCCCTGGG + Intronic
1164684628 19:30158630-30158652 GGATATGCAGGGAATTCCCTGGG + Intergenic
1164830658 19:31317552-31317574 GTCTGAGCAGGGAGTTCCTTAGG - Intronic
1165145642 19:33728384-33728406 GTCTCTGCTGGGCTTGACCTAGG + Intronic
1165338582 19:35193484-35193506 GTCTGTGCATGGATTTCTGTGGG + Intergenic
1165855730 19:38878504-38878526 CTCCCTTCAGAGATTTCCCTGGG + Intergenic
1166256850 19:41612741-41612763 GTGTCTGCAGGGATTATCCATGG + Intronic
925034081 2:672757-672779 GTCCCTGCAGGGGTGTCCCTGGG - Intronic
925422641 2:3725121-3725143 GTCTATGCTGGGAGTTTCCTGGG + Intronic
927552772 2:24013432-24013454 GTCTCTGCTGGCATCTTCCTTGG + Intronic
927888140 2:26730915-26730937 GTCTCTGCTGGGTCTTTCCTAGG + Exonic
929585800 2:43113590-43113612 GGCTCTGCTGGGATTTCTCCAGG - Intergenic
929997241 2:46836394-46836416 GTCTCTGCAGGGCTCTCCTGGGG - Intronic
930658477 2:54030428-54030450 GTCTGGGCACTGATTTCCCTAGG + Intronic
931287932 2:60848285-60848307 GTCTCAGCACCGATTTCTCTAGG - Intergenic
936687289 2:114842560-114842582 GTCACTTTAGGGATTTTCCTGGG - Intronic
938065165 2:128278083-128278105 GTACCTGCAGGATTTTCCCTGGG - Intronic
943203543 2:184860747-184860769 GTGTCTGCAGGGGATTGCCTGGG + Intronic
946915399 2:224515474-224515496 GTCTCAGCAAGGATCTCTCTGGG + Intronic
948890225 2:240903764-240903786 GTCACTGCAGGGTTTGCCCACGG - Intergenic
1169251002 20:4061049-4061071 GGGCCTGGAGGGATTTCCCTGGG + Intergenic
1169400571 20:5275841-5275863 GTCTCTCCAGAAATTTGCCTTGG + Intergenic
1170612661 20:17927413-17927435 GTCTCTGATGGGCTTTTCCTTGG - Intergenic
1171192049 20:23165672-23165694 CTCTCTGCAGGCATCTCCCATGG - Intergenic
1171245691 20:23608076-23608098 CTCTCTGCAGGGCTATCCCCAGG + Intergenic
1172184435 20:33022485-33022507 GGCTCTGTGGGGATTTCCCTAGG + Intronic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1173140248 20:40475526-40475548 ATCTCTGCTTGGATTCCCCTGGG - Intergenic
1173582455 20:44157233-44157255 CCCTCTCCAGGGATTGCCCTTGG + Intronic
1174085873 20:48006812-48006834 TTCCCTGCAGGGCTCTCCCTGGG - Intergenic
1174156855 20:48521349-48521371 GTCTATGCAGGGAATTGCCAGGG - Intergenic
1174879949 20:54268140-54268162 CTCTCTGCATGAATTTCCATTGG + Intergenic
1175325539 20:58125215-58125237 GGCTGTGCTGGGATTTCACTTGG - Intergenic
1175825194 20:61933183-61933205 GTCTCAGCAGGGATTGCCCTGGG + Intronic
1180190272 21:46159583-46159605 GGCTCTGTGGGGGTTTCCCTGGG - Intergenic
1180196310 21:46196498-46196520 GTGTCTGCAGGGGCTTCCCAAGG - Intronic
1181546095 22:23603492-23603514 GTCTCTGGAGGGATTTGGGTAGG - Intergenic
1181755863 22:25024287-25024309 TTCTCTGCATGGATTTTCCTGGG - Intronic
1182458251 22:30466403-30466425 CTCTCTGAAGGGATCTCTCTTGG - Intronic
1182921975 22:34088627-34088649 TTCTCTGCAGAAGTTTCCCTTGG + Intergenic
1183304481 22:37075098-37075120 GTCACTGCAGGGGGTTCCCCCGG + Intronic
1184155486 22:42664034-42664056 GACTCTGCAGGAAGCTCCCTGGG - Intergenic
1184300031 22:43553244-43553266 GTGTCTGCAGGGAACTCCCTGGG + Intronic
1184394044 22:44222198-44222220 GTCTCTGCAGGGCTGCCCCCTGG + Intergenic
1184666630 22:45992715-45992737 GCCCCTGCAGGCACTTCCCTGGG + Intergenic
1184852096 22:47126789-47126811 GTCAGTGGAGGGATTTCCCTGGG - Intronic
949374015 3:3366789-3366811 GTCTCTGCAGCCATGTCTCTAGG - Intergenic
950178736 3:10896001-10896023 CTCTCTGCAGGCATTTACCTTGG - Intronic
950207067 3:11088924-11088946 CTGTCTGCATAGATTTCCCTGGG - Intergenic
950556517 3:13699262-13699284 GTCTCTGCAGGGCTCTCCTGGGG + Intergenic
951458965 3:22928380-22928402 GTCTGGGCACCGATTTCCCTAGG - Intergenic
953818297 3:46181531-46181553 GTCTTTGCATGGATTTCTTTAGG + Intronic
954885379 3:53868935-53868957 GACTCAGCAGGGATTTTTCTCGG - Intronic
955596720 3:60598948-60598970 GTCTGCCAAGGGATTTCCCTAGG + Intronic
956166225 3:66400251-66400273 CTCTCTGCAGGGAAGCCCCTAGG + Intronic
956475552 3:69616574-69616596 CTCTCACCAGGAATTTCCCTTGG + Intergenic
956973895 3:74558044-74558066 GTCTCTCCAGGAACTGCCCTCGG + Intergenic
960326123 3:116298242-116298264 GGCTCTGCAGGGATTTCTGTTGG - Intronic
963601491 3:147382823-147382845 CTCTCTGCAGACATTTCCCAAGG + Intergenic
964118462 3:153160111-153160133 GGCTCTGCAGGCAAATCCCTGGG + Intergenic
964537475 3:157739441-157739463 GTTTCAGCAGATATTTCCCTAGG + Intergenic
967819281 3:193826209-193826231 GTCATTGCAGGGATTTCAGTCGG - Intergenic
968464623 4:744421-744443 GTGTCTGCAGGGGTCTCCCCAGG - Intronic
969401614 4:6959440-6959462 GTCTCTGCTGGGCCTTCCCCCGG + Intronic
969500239 4:7548283-7548305 GTCTCTGCAGGGCTAATCCTTGG + Intronic
973294263 4:48498522-48498544 GTCTCTGCAGGCATCTACTTTGG + Exonic
975481955 4:74890712-74890734 TTCTCTGCAGGAATTTCACCAGG + Intergenic
976094871 4:81498099-81498121 ATCTCTGGAAGAATTTCCCTGGG + Intronic
976862982 4:89688882-89688904 GTCTCTGCAGGAAGTTCTATTGG - Intergenic
978242483 4:106533483-106533505 GTCTGGGCACTGATTTCCCTAGG + Intergenic
978342426 4:107732934-107732956 GTCTGGGCACTGATTTCCCTAGG - Intergenic
978343452 4:107740958-107740980 GTCTGGGCACTGATTTCCCTAGG - Intergenic
978836976 4:113162664-113162686 GCCTCTACATGGATCTCCCTGGG + Intronic
978920709 4:114179982-114180004 GTCTCTGGAGGGAGTTGCATTGG + Intergenic
984101784 4:175495788-175495810 GTCTCTGCAGGCCTTTCAGTTGG + Intergenic
984171199 4:176361642-176361664 TTCTGTGTAGGGATTTTCCTAGG - Intergenic
985097629 4:186428620-186428642 GTCTGGGCACTGATTTCCCTAGG - Intronic
985870311 5:2549148-2549170 GTCTCTGCATGAATATCACTAGG + Intergenic
986507017 5:8462550-8462572 ATCTCTGCATGGATCTCCCATGG - Intergenic
986805552 5:11305442-11305464 GTCCCTGCAGCCATTTCCCCAGG + Intronic
986974142 5:13376216-13376238 CTCTCTGCTGTGATTTTCCTGGG - Intergenic
987200999 5:15578052-15578074 GGCTATGCAGGTGTTTCCCTTGG + Intronic
989163187 5:38410901-38410923 GTGTTTCCAGGGATTTCTCTGGG - Intronic
989181576 5:38582827-38582849 GTGGCAGCAGGGAATTCCCTGGG - Intronic
989623862 5:43410999-43411021 GTCCCTGCAGGCATTTGCTTAGG - Intronic
991144046 5:63280175-63280197 GTTTCTGCATGGGTTTCTCTTGG + Intergenic
992092641 5:73332159-73332181 GTCTTAGCATGGATTTCCTTGGG + Intergenic
994956970 5:106545084-106545106 GTCTCTGGAAGGACATCCCTTGG + Intergenic
997297281 5:132776381-132776403 GTCCCTGCAGGGGTCTCACTGGG - Intronic
998011166 5:138696761-138696783 GCCTCTGCGGGGATTTCCCAGGG - Intronic
998821231 5:146059861-146059883 GTCTCTGCAGGGATCCATCTGGG - Exonic
1001231930 5:169996272-169996294 GTCTCTCCAGGGATTCCCACGGG + Intronic
1004196295 6:13508805-13508827 ATCTCTGCATGGATTTCTGTTGG + Intergenic
1005985489 6:30871510-30871532 GCCTCTGCATGGATTTCTTTGGG + Intergenic
1008937585 6:57008372-57008394 GTCTGGGCACTGATTTCCCTAGG + Intronic
1009627800 6:66159793-66159815 TTTTCTCCAGGAATTTCCCTAGG + Intergenic
1010072645 6:71761988-71762010 TTCTCTTCAGGCTTTTCCCTTGG + Intergenic
1021285081 7:18770939-18770961 CTGTCTGCAGGGCTTTCCCCAGG - Intronic
1024554791 7:50594103-50594125 GTCTATGCAGCACTTTCCCTAGG + Intronic
1025708752 7:63889670-63889692 TTCTGTGCAGGGAACTCCCTTGG + Intergenic
1025996378 7:66529977-66529999 ATCTCTGCAGGGACTGGCCTTGG - Intergenic
1028089374 7:86679111-86679133 TTCTCTGCAGTGATTTGCCATGG + Intronic
1028482260 7:91320544-91320566 GTCTCTGCTGAGACATCCCTTGG - Intergenic
1029103594 7:98155472-98155494 GTCTTGGCATGGATTTCCTTGGG - Intronic
1029827928 7:103220491-103220513 ATCTTTGCATGGATTTCTCTAGG + Intergenic
1032408269 7:131673570-131673592 GGGTCTTCAGGGTTTTCCCTTGG + Intergenic
1033369448 7:140695600-140695622 GTCACTGCAGGTCTGTCCCTGGG - Intronic
1034010872 7:147528135-147528157 GTCTCTTCATGGACTTCCTTGGG - Intronic
1036655504 8:10674627-10674649 GTCTCTGCAGGGAATGACATGGG - Exonic
1037165719 8:15825946-15825968 GTCTGTACATGAATTTCCCTAGG - Intergenic
1038092409 8:24269059-24269081 GTCTGGGCACCGATTTCCCTAGG - Intergenic
1038436751 8:27541691-27541713 CTCCCTTCAGGGGTTTCCCTAGG + Intronic
1039663427 8:39493222-39493244 GCCTCTGCAGTGATTTTCTTTGG + Intergenic
1040990923 8:53348292-53348314 GTCTGGGCACTGATTTCCCTAGG + Intergenic
1043286654 8:78540434-78540456 GGCCCTGCAGGGATTTGACTAGG - Intronic
1043785735 8:84397440-84397462 ATCTCTGCAGGGATTTTTCTGGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049659550 8:143813647-143813669 GTCTCTGCAGGCACTGCCCGGGG - Exonic
1049687781 8:143945859-143945881 GCCACTGCAGGCATTTCCCTCGG - Intronic
1050599569 9:7236704-7236726 GTCTCTCCAGTGAGATCCCTTGG + Intergenic
1053025388 9:34724769-34724791 GGCTCTGCTGGGATTTCCACGGG + Exonic
1053036917 9:34833831-34833853 GGCTCTGCTGGGATTTCCACGGG + Intergenic
1056924676 9:90823057-90823079 GTCTCAGCTGGGAATTCCCAAGG + Intronic
1057176160 9:93001700-93001722 GTCTGGGCACTGATTTCCCTAGG + Intronic
1057566125 9:96167508-96167530 GTGTCTGCAGAGCTTTCCTTAGG + Intergenic
1057969683 9:99542443-99542465 GTCTCAGCATGGCTTTCCCTGGG + Intergenic
1060854277 9:126902472-126902494 GTCTGGGCACTGATTTCCCTAGG + Intergenic
1061027736 9:128061384-128061406 GTCGCTGCAGGGACTTCCTGAGG - Exonic
1062102749 9:134737119-134737141 GGCTCTGCAGAGAGTTCCCTGGG - Intronic
1186171433 X:6881450-6881472 GTGTTTGCAGAGATATCCCTCGG + Intergenic
1189313262 X:40034880-40034902 GTCTCTGCAGGGGTTTCAGTGGG + Intergenic
1192291594 X:69801999-69802021 GTCTCTCCAGGAATTCGCCTAGG - Intronic
1194999807 X:100632501-100632523 GTCGTTGCAGGAATTTCCTTTGG - Exonic
1195030471 X:100922798-100922820 ATCTCTGCAGAGGTTCCCCTGGG - Exonic
1195262335 X:103145016-103145038 GTCTCATTAGGGATATCCCTTGG + Intergenic
1196082130 X:111644149-111644171 GTCTGGGCATCGATTTCCCTAGG + Intergenic
1197931672 X:131702991-131703013 GTCTGGGCATCGATTTCCCTCGG - Intergenic
1199703856 X:150406684-150406706 GCCTCTGCCTGAATTTCCCTTGG - Intronic