ID: 1121440377

View in Genome Browser
Species Human (GRCh38)
Location 14:93945093-93945115
Sequence CAGTGGGGCTCCTTCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121440377 Original CRISPR CAGTGGGGCTCCTTCTCTCC TGG Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900857972 1:5201183-5201205 CACCAGGGCTCCTTCTCTGCAGG - Intergenic
900909614 1:5585776-5585798 CACTGTGGCTCCCTCTCCCCTGG + Intergenic
901748886 1:11393759-11393781 CAGTGCCCCTCCTTCTCTCCAGG + Intergenic
902171843 1:14617987-14618009 CAGCGGGGCTCCCTCTCCCAGGG - Intronic
902406991 1:16189834-16189856 CAGTGGGTCTCCTGGTGTCCAGG + Intergenic
902625603 1:17674405-17674427 CATTGGGGCACCTGCTCTGCAGG - Intronic
902646007 1:17798360-17798382 CAGTGGGTCTTCTGCCCTCCTGG - Intronic
903029529 1:20452939-20452961 CTGTGGGGCTCCTTCTGTGGAGG - Intergenic
903359302 1:22766859-22766881 CACTGGGGTTCCTTCTCACCAGG - Intronic
906146438 1:43563496-43563518 TCCTGGGGCTCCTTCTGTCCTGG - Intronic
907633428 1:56107447-56107469 CACTGGGGCTCCTGGGCTCCTGG - Intergenic
909318796 1:74255780-74255802 CAGTCAGTCTCCTTCTCACCTGG + Intronic
909599107 1:77442335-77442357 GGGTGGGGCTCCTTCTCTAGAGG + Intronic
913334503 1:117696573-117696595 CAGTGGGGGTTCTGCTCTCCTGG - Intergenic
915165313 1:153945153-153945175 CCTTGGGGCTCCTACTCCCCGGG - Intronic
916214863 1:162385809-162385831 CTCTGGGGCTTCTCCTCTCCTGG + Intronic
918649154 1:186938748-186938770 TAGTAGGGCACCTTCTCTCTTGG + Intronic
920042993 1:203116097-203116119 TTGGGGGGCTCCTTATCTCCTGG - Intronic
922730055 1:227945051-227945073 CGCCGGGGCTGCTTCTCTCCTGG - Intronic
923910066 1:238431436-238431458 CAGTGGGGCTGCCACACTCCAGG - Intergenic
1062786994 10:273042-273064 CAGTGTGACTGCTTCTGTCCAGG + Intergenic
1062907380 10:1187829-1187851 CATGGGGGCTTCTTCTCACCAGG + Intronic
1062969176 10:1633028-1633050 GAGTGGGCCTCCCTCTCCCCAGG + Intronic
1064254576 10:13732897-13732919 CAGTGGTGGTCCTTGTCTCCAGG + Intronic
1067528332 10:47051835-47051857 CAGTAGGGATCCTTCCCTGCAGG + Intergenic
1069822199 10:71235017-71235039 CAGGGGGGCCCCTCCTCCCCCGG + Intronic
1070669327 10:78367077-78367099 CAGTGGGGCTCCAAGTCTTCGGG + Intergenic
1071404757 10:85319149-85319171 CAGTGATGCTTCTTTTCTCCTGG + Intergenic
1071753129 10:88503971-88503993 CAGTTGGCTTCCCTCTCTCCAGG - Intronic
1071880981 10:89897999-89898021 CAGTGGGGCTGCCACACTCCAGG + Intergenic
1072158706 10:92746889-92746911 CAGTGAGCCTCTTGCTCTCCTGG + Intergenic
1074466903 10:113691642-113691664 CAGTGGGGCTGCCACACTCCAGG + Intronic
1075003147 10:118812525-118812547 CAGTTGGGAACCTGCTCTCCAGG + Intergenic
1075072696 10:119329372-119329394 CAGTCTGCCTTCTTCTCTCCCGG - Intronic
1075715689 10:124553927-124553949 CAGGGGGGCTCTGTCCCTCCTGG - Intronic
1076325408 10:129616772-129616794 CAGTGGGGCATGTTCTTTCCTGG - Intronic
1076380094 10:130019079-130019101 CAGTGGGGCCCCCACTCACCTGG + Intergenic
1077428816 11:2504005-2504027 GAGTGCGGATCCTTCTCTGCTGG - Intronic
1077596286 11:3534541-3534563 CAGTGGCGCTCCTGCCCACCTGG + Intergenic
1079337028 11:19578887-19578909 CAGAGGGGTTTCTGCTCTCCTGG - Intronic
1079627618 11:22634670-22634692 CAGTGGGGCTGCCATTCTCCAGG + Intronic
1083150441 11:60788695-60788717 CAGAGGGTCTCCCTCTTTCCTGG - Intronic
1083615224 11:64022786-64022808 CAGTGAGGCCCCTGCTCCCCTGG - Intronic
1085304595 11:75477907-75477929 CAGTGGGGCTCCGTCTCACTTGG + Intronic
1089579715 11:119473859-119473881 CAGAGAGGCTCCTTCTCTAAAGG - Intergenic
1089589493 11:119531390-119531412 CAGCAGGGCTCCTGCTCCCCTGG - Intergenic
1091606333 12:1955035-1955057 CAGTGAGACTCCATCTCTACAGG - Intronic
1092528529 12:9325756-9325778 GACCGGGGCTCCTTCTCTCTTGG - Intergenic
1093948444 12:25136264-25136286 CAGTGGAGCTACTGCGCTCCAGG - Intronic
1097832490 12:64240336-64240358 CAGTGGAGCTCCTTGTCCTCAGG - Intergenic
1100431954 12:94538922-94538944 GAGAGGGGCTCCTTTTCTCTGGG - Intergenic
1100661241 12:96701436-96701458 CAGGGGGGCTCCTGCTTTCCTGG + Intronic
1102044845 12:109823256-109823278 CACTGGGGCTCTGTCTGTCCTGG - Intronic
1102875602 12:116446341-116446363 TATGGGGGCTCCTTCTATCCTGG - Intergenic
1102957130 12:117066064-117066086 CACACCGGCTCCTTCTCTCCTGG + Intronic
1103208021 12:119145527-119145549 CACTGGGGCTCCCCTTCTCCTGG - Exonic
1103988637 12:124783892-124783914 CAGTGTGGCTCCCTCCCTGCAGG - Intronic
1104781037 12:131420678-131420700 CAGTGGGGCCCATGCACTCCAGG - Intergenic
1105599356 13:21872111-21872133 AAGTGTGACTCCTTCTCTCCAGG + Intergenic
1105756318 13:23467264-23467286 CAGTGGGGCTCCTGCCACCCCGG - Intergenic
1105795477 13:23848205-23848227 CAGTGTGCCTGCTTTTCTCCAGG - Intronic
1105810068 13:23987301-23987323 CAGTGTGGCTCCTCATTTCCCGG - Intronic
1106361780 13:29038286-29038308 CAGTCAGGCTCCTCCTCTGCAGG + Intronic
1107818338 13:44264251-44264273 CAGTGGGGTTGATTCCCTCCTGG - Intergenic
1109676184 13:65677581-65677603 CAGTGTGGCTGCTTCTCTGAAGG + Intergenic
1110209290 13:72953431-72953453 CAGTGGGACTCCCACACTCCAGG + Intronic
1118586613 14:67359560-67359582 CAGTGAGGGTCCTTGTTTCCTGG - Intronic
1120599916 14:86490421-86490443 CACTGGGGCTCCTTCAGTTCTGG + Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1121587358 14:95071296-95071318 CAGAGGGGGTCTTTCTCGCCGGG + Intergenic
1121612550 14:95291551-95291573 CAGTCTGACTCCGTCTCTCCTGG - Intronic
1121802331 14:96785001-96785023 CAGTGTGGCTCCTTCTTTCAAGG + Intergenic
1122548522 14:102538121-102538143 CAGTGGGGCTCCTGCTCCCACGG - Intergenic
1122942325 14:104986964-104986986 CAGAGCGTCTGCTTCTCTCCTGG + Intronic
1127005201 15:54561215-54561237 CAGTGCTGTTCATTCTCTCCGGG + Intronic
1127982847 15:64046851-64046873 CAGTGGGGCTTCCTCGCTCACGG - Intronic
1129000533 15:72329749-72329771 GACTGGGGCTCATTCTGTCCAGG - Intronic
1129516991 15:76162976-76162998 CACCGGGGCTCCTGCTGTCCTGG + Intronic
1129667105 15:77585336-77585358 GAGAGGGGCTCCTCCACTCCAGG + Intergenic
1130190386 15:81729677-81729699 CAGTTCAGCTACTTCTCTCCAGG + Intergenic
1130986197 15:88846176-88846198 CAACTGGGCTCCTTCTGTCCAGG + Intronic
1134292308 16:12912180-12912202 AAGTGGGGCTCGCTCACTCCAGG - Intronic
1134827837 16:17298654-17298676 CAGTGGAGCCCCTTCCCTGCCGG - Intronic
1137253638 16:46757983-46758005 CAGTGGGGCTGCTTGTACCCTGG + Intronic
1137675600 16:50302280-50302302 CCGGGGGGCTCCTCCTCTCCAGG + Intronic
1138184093 16:54963231-54963253 CAGGAGGGTGCCTTCTCTCCTGG - Intergenic
1139526167 16:67518206-67518228 GCGTGGGGCACCGTCTCTCCAGG - Intergenic
1140708148 16:77650267-77650289 CAATGGGGCACCTACTCTTCAGG - Intergenic
1141755022 16:85985152-85985174 CAGTGAGGCCCCGTCTCCCCAGG - Intergenic
1141938137 16:87255498-87255520 CAGAGCGGCACCTTCTCTCTCGG + Intronic
1142931163 17:3284979-3285001 TAGTGAGGCGCTTTCTCTCCTGG + Intergenic
1143055163 17:4156915-4156937 CAGCGGGGCTCCTTAGCACCTGG - Exonic
1144021726 17:11244109-11244131 CATTGGGGCAGCTTCTCTCTGGG + Intronic
1147648769 17:42050344-42050366 CAGGGGAGCCCCTTCTCACCAGG - Intronic
1149596800 17:57869038-57869060 CTGAGGGGCTCCCTCACTCCTGG + Intronic
1152369504 17:79877648-79877670 CACTGGGGCTCCTCCAGTCCGGG + Intergenic
1152386115 17:79975803-79975825 AAGTGGGGCTCATGCTCTGCAGG - Intronic
1152403162 17:80081854-80081876 CCCTGTGGCTCCTTGTCTCCAGG + Exonic
1152542457 17:80983084-80983106 CAGAGGGGTTCCTGCTTTCCAGG + Intergenic
1152594483 17:81231764-81231786 CAGCGCGGCTCCTGCTCTCCAGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152750043 17:82058474-82058496 CAGTGGGGCTGCTCCCCTGCTGG - Intronic
1153490351 18:5640766-5640788 CAATGTGCCACCTTCTCTCCAGG - Intergenic
1156326178 18:36077440-36077462 CAGAGGGGCTCCTCACCTCCCGG + Intergenic
1162552539 19:11365567-11365589 CAGAGGGGCTCCCTCACCCCGGG + Exonic
1162765869 19:12919108-12919130 CATTGGGGCTCCCTCTCATCAGG - Intronic
1162930236 19:13953876-13953898 CAAGGGGGCTCCTCCTCCCCGGG - Intronic
1163442356 19:17328458-17328480 TAGTGGGGCTCCCTTCCTCCAGG + Exonic
1163908686 19:20169525-20169547 CTGTGGGGCTCCAGCTTTCCAGG - Intronic
1163933665 19:20422737-20422759 CTGTGGGGCTCCAGCTTTCCAGG + Intergenic
1165811788 19:38616207-38616229 CTGTGGGGCTGGTTCTCTCCAGG - Exonic
1166757631 19:45203163-45203185 CAGTGGGCCTCATGCCCTCCAGG + Intronic
1168161866 19:54515822-54515844 CACTGGGGCTGGGTCTCTCCTGG + Intergenic
926915262 2:17885275-17885297 CAGTGGGACTCCTCCTTACCTGG + Intronic
927109229 2:19852264-19852286 CAGAGGGGCTGCTTCACTGCTGG + Intergenic
927833174 2:26370783-26370805 CAGAGGGGCTCCTCACCTCCCGG + Intronic
929479895 2:42295588-42295610 CACTGCAGCTCTTTCTCTCCTGG - Intronic
930655035 2:53999379-53999401 AAGTGGGACTCCTTCCTTCCTGG - Intronic
933642989 2:84784157-84784179 CAGTGGAGCTCATTCTTTCTTGG + Intronic
935717037 2:105948303-105948325 TAGTGGGGCTCCTTGACTCTTGG - Intergenic
936091813 2:109506464-109506486 GAGTGTGGCTCCCTCTCTCCAGG - Intergenic
936379166 2:111968905-111968927 CAGTGTGGCTCCTTCTGGGCTGG + Intronic
938227265 2:129626760-129626782 CAGTGGGCCTCTTCTTCTCCAGG - Intergenic
939606928 2:144264889-144264911 CCATTGCGCTCCTTCTCTCCTGG - Intronic
940700867 2:157041197-157041219 CACTGGGGCTCCTGTTCACCAGG + Intergenic
942225886 2:173815673-173815695 CAGTGTGGCTCCTGCTCTTCTGG - Intergenic
945072297 2:206004159-206004181 CACTGGTGCTCATTCCCTCCTGG - Exonic
945211411 2:207386931-207386953 AATTGGGGCTCCATCTCTCTGGG - Intergenic
946066701 2:216994146-216994168 CAGTGGAGCTGCTTTTCTTCTGG + Intergenic
948456486 2:238106838-238106860 CCGTGGGGCTCCTTCGCATCTGG - Intronic
1169796675 20:9469961-9469983 CAGTGGGGTTCCTTCTTTTGGGG + Intronic
1170906154 20:20516739-20516761 CAGTGGGGCTGCCACACTCCAGG - Intronic
1172227984 20:33317894-33317916 CAGTGTGGCTCCTGCCCTCATGG - Intergenic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1173947172 20:46960850-46960872 CTGTGGGGCCCCTTCCCTGCTGG + Intronic
1174569416 20:51491080-51491102 CAGTGGTACTTTTTCTCTCCTGG - Intronic
1174940329 20:54919526-54919548 CAGTGGAGAACCTTCCCTCCTGG - Intergenic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1176121609 20:63456646-63456668 CTGTAGGGCTGCTTCCCTCCTGG - Intronic
1176218243 20:63958188-63958210 CAGTGGGGCCCCTTCTCCCTGGG + Exonic
1176228735 20:64019505-64019527 CTGTGGTGCTGCTTCCCTCCCGG + Intronic
1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG + Intergenic
1176658616 21:9613006-9613028 CAGTGGGGCTACTGGGCTCCAGG + Intergenic
1177853662 21:26377765-26377787 CAGTGGTTCTCTTTTTCTCCAGG + Intergenic
1178580184 21:33831688-33831710 CAGTGTGGCTCTTCCTGTCCTGG - Intronic
1179747605 21:43451589-43451611 CCTTGGGGCTCCTGCTCTCGGGG - Intergenic
1180557931 22:16592453-16592475 AGGTGGGGCTCCTCCTCTTCTGG + Exonic
1180966177 22:19789043-19789065 CTGTGGGCCTGCGTCTCTCCTGG - Intronic
1181047767 22:20223708-20223730 GAGTGAGGCTCCATCTCTGCTGG + Intergenic
1181347487 22:22230472-22230494 CGGTGGGGCTCCATGGCTCCTGG + Intergenic
1182150267 22:28022593-28022615 CAGTGTAGCTCCTGCTCTGCTGG + Intronic
1183498734 22:38165333-38165355 CACTGGGGATCCTGCTTTCCTGG - Intronic
1183946162 22:41327034-41327056 CAGAGTGCTTCCTTCTCTCCTGG + Intronic
1184189586 22:42885863-42885885 CTGTGGAGCTCTTTCTCTGCTGG - Intronic
1184398692 22:44260972-44260994 CAGTGGCACCCCTTCCCTCCCGG - Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
1185163294 22:49242718-49242740 CAGTGGGAGTCCATCTCCCCTGG + Intergenic
1185199442 22:49492464-49492486 CAGTGGGCCACCTTCCTTCCCGG - Intronic
1185208630 22:49554330-49554352 CACTGGGGCTGCTGTTCTCCCGG + Intronic
950442071 3:13016043-13016065 AAGTAGGGCACCCTCTCTCCAGG - Intronic
950767490 3:15284038-15284060 CATTGGTGCTTCTTCTCTCCAGG - Intronic
952944857 3:38472526-38472548 GAGTGGCACTCCTTCTCACCTGG + Intronic
956129487 3:66039763-66039785 CGGCGGGGATCCTTATCTCCTGG - Intergenic
957560298 3:81813051-81813073 CAGTGTGGCTGCTCCTCTCACGG + Intergenic
959063517 3:101636053-101636075 GACTGGGGCTCCCTCTCTCTTGG + Intergenic
960996695 3:123345000-123345022 CAGTGGGGGTATTTCTCTCTGGG - Intronic
962662797 3:137621220-137621242 GAGTGGGGCACAATCTCTCCTGG - Intergenic
962829845 3:139130430-139130452 CAGCGTGGCTGCTTCTCTGCAGG - Intronic
964635926 3:158858713-158858735 CAGTGGGGCTGCCTCACTCCAGG + Intergenic
965096644 3:164237027-164237049 CAGCTAGGCTCCTGCTCTCCAGG - Intergenic
968072041 3:195790159-195790181 GAGAGGAGCTCATTCTCTCCAGG - Exonic
968662394 4:1804129-1804151 CTGCTGGGCTCCTTCTCTCCAGG + Intronic
968811959 4:2804172-2804194 CTGGGGGTCTCCTTCTGTCCCGG + Intronic
968982307 4:3856891-3856913 CTGCGGGGCTGCTGCTCTCCTGG - Intergenic
969284892 4:6196979-6197001 AAGTGGGGCTCCCTGACTCCGGG - Intronic
969289324 4:6228544-6228566 CAATGGGGCCCCTGCTGTCCTGG + Intergenic
969440635 4:7214795-7214817 CAGTGGGGCTGCTTTTCTGGTGG + Intronic
971386157 4:26142119-26142141 CAGTGGGGCTCCTGGGCTCAGGG - Intergenic
971458994 4:26873872-26873894 CAGTGATGCTCCTTCTCCCAGGG + Intronic
972237472 4:37150683-37150705 CAGTGGGTTCCCTTCTCGCCTGG + Intergenic
973644609 4:52937458-52937480 CAGATGGTCTGCTTCTCTCCTGG - Intronic
974856324 4:67465799-67465821 CAGTGGGGCTGCCACACTCCAGG - Intergenic
975887570 4:78983502-78983524 CAATGGGGCTTTTTCTCTCTAGG + Intergenic
979583046 4:122382597-122382619 TAGTGAGACTCCTTCTCTACAGG - Intronic
983286922 4:165751740-165751762 CAGTGTGGCTCCTATTTTCCTGG - Intergenic
984854560 4:184183581-184183603 CAGTGGTGTTCCTTCTTTCTTGG + Intronic
984881238 4:184411625-184411647 TAGTGAAGATCCTTCTCTCCTGG - Intronic
985064256 4:186105345-186105367 CAGTGGGGACCCTGCTCTCTTGG + Intronic
985416791 4:189743061-189743083 CAGTGGGGCTACTGGGCTCCAGG - Intergenic
985578627 5:685249-685271 AGGTCGGGCTCCTGCTCTCCAGG + Intronic
985758431 5:1732821-1732843 AAGGGGGGCTCCATGTCTCCTGG - Intergenic
987073624 5:14360399-14360421 CAGTGGTGAGCCTGCTCTCCTGG + Intronic
989365763 5:40653414-40653436 CAGTGGGGCTGCCACACTCCAGG - Intergenic
994496341 5:100517861-100517883 CAGTGGGGCTGCCACACTCCAGG - Intergenic
995787047 5:115841598-115841620 CAGTGGGCGTGCTTTTCTCCAGG + Exonic
996616019 5:125441782-125441804 CAGTGGGGCTCCCAGGCTCCAGG - Intergenic
998788388 5:145737856-145737878 CAGTGGGGCTCATTACCTGCTGG - Intronic
1002182475 5:177437957-177437979 CAGTGGGCCTCATTATCTCCAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1004340981 6:14807126-14807148 CGGGGGGGCTCCATCTGTCCCGG - Intergenic
1004888606 6:20075290-20075312 CAGTGGAGCTACTTGGCTCCGGG - Intergenic
1006672611 6:35738737-35738759 TAGTGGGGGTCCTTCTCTTTGGG - Intronic
1007065679 6:38988061-38988083 CAGTGGAGCTGCTTCTCCCATGG - Intronic
1007171367 6:39865625-39865647 AAGTGGGGCTCCTTGTGTCTGGG + Intronic
1007478612 6:42135495-42135517 CAGTGAGGCTCCTCCGCTCGGGG - Intronic
1007662885 6:43497185-43497207 CAGTGGCACTCCTTCCCTCCAGG + Intronic
1007737096 6:43988365-43988387 CAGGGGAGCCCCTTATCTCCTGG - Intergenic
1008571393 6:52820545-52820567 CAGGTGGGCTCCTTCTTTCCAGG + Intergenic
1009040543 6:58171058-58171080 TAGTGTGTTTCCTTCTCTCCAGG - Intergenic
1009216400 6:60925588-60925610 TAGTGTGTTTCCTTCTCTCCAGG - Intergenic
1013495053 6:110689806-110689828 CAGTGGGGCTGCCACACTCCAGG - Intronic
1013791716 6:113844739-113844761 CAGTGTAGCTCCTTCACCCCAGG + Intergenic
1014761569 6:125363113-125363135 CACTCGGGGTCCTTCCCTCCCGG + Intergenic
1015120261 6:129693228-129693250 CTGTGAGTCTCCTTATCTCCAGG - Intronic
1017658993 6:156655734-156655756 CTGTGGCTCTCTTTCTCTCCAGG - Intergenic
1018788826 6:167130904-167130926 CTCTGGGCCTCCTTCTCTCAGGG + Intronic
1018940743 6:168307828-168307850 CAGTGGGCCACCTGCTCTCCTGG + Exonic
1019444831 7:1065977-1065999 CGGCGGGGCCCCTGCTCTCCTGG - Intronic
1019451794 7:1102668-1102690 CAGTGGGTCACCTGTTCTCCAGG - Intronic
1019721470 7:2574920-2574942 CTGTGCGGCTCCTTCTGTCTTGG + Intronic
1021899758 7:25273167-25273189 CATTGGGACTCCTTCTTTACTGG + Intergenic
1022529098 7:31056159-31056181 GAGAGGGGCTCCTTATCTCAGGG + Intronic
1024058460 7:45681490-45681512 CAGTGGGGGTCCAGCTTTCCTGG + Intronic
1024405607 7:48976021-48976043 CTGTGGGTCTCCTGCTTTCCTGG - Intergenic
1024915226 7:54491832-54491854 CAGTGAGGCTCCTTCCCCCAGGG + Intergenic
1025250823 7:57350322-57350344 CACACGGGCTCCTTCTCACCAGG + Intergenic
1027864459 7:83629033-83629055 CAGTCAGGCTCCTCTTCTCCAGG + Intronic
1028395947 7:90369040-90369062 CAGTCGGGCTTCTTCGCTGCAGG + Intronic
1031974788 7:128086747-128086769 CAGCAGGGCACGTTCTCTCCAGG + Intronic
1032566774 7:132954720-132954742 CAGTGGGACTGCTGCTGTCCTGG - Intronic
1033005517 7:137557753-137557775 CACTGAGGCTCCAACTCTCCTGG + Intronic
1033608106 7:142942159-142942181 AAGTTGGTCTCCTCCTCTCCTGG + Intronic
1034619385 7:152445552-152445574 AGGTGGGGCTCCTCCTCTTCCGG - Intergenic
1035027583 7:155836044-155836066 CAGTGGGGCTCTGTCCCGCCAGG - Intergenic
1041713769 8:60915207-60915229 CCTTGGGCCTCCTTCTCTCCTGG + Intergenic
1043718318 8:83511253-83511275 CAGTGGGGCTACTGGGCTCCAGG + Intergenic
1044604482 8:94036796-94036818 AAGTGTGGCTCCTGGTCTCCTGG + Intergenic
1046284759 8:112080130-112080152 CAGTGGGGCTGCTACACTCCAGG + Intergenic
1047227255 8:122967436-122967458 CAGTGGGGCTGCTGGGCTCCAGG + Intronic
1048214847 8:132484684-132484706 CAGTGGGGCACCTTCCCTAGGGG + Intergenic
1048327014 8:133447664-133447686 CAGTGAGGCTCCCTGTCCCCGGG + Intergenic
1049281698 8:141752837-141752859 CACTGGCGCTCCCTCTGTCCTGG - Intergenic
1049892475 9:83443-83465 CAGAGGGGCTCCTCACCTCCCGG + Intergenic
1054997313 9:71407266-71407288 CAGTGGGGCATCATCTCACCCGG + Intronic
1057254838 9:93537247-93537269 CACTGGGGTTCTTTCTTTCCAGG + Intronic
1057478989 9:95429332-95429354 CAGTGATGCTCCTTCACACCGGG - Intergenic
1058408568 9:104704355-104704377 CAGTGAGGCTCCTCTGCTCCAGG - Intergenic
1061923585 9:133795254-133795276 CTGGGGAGCTCCTTCGCTCCTGG - Intronic
1062527559 9:136984468-136984490 GATTGGGGCTCTTTCTCCCCAGG + Exonic
1203636343 Un_KI270750v1:116585-116607 CAGTGGGGCTACTGGGCTCCAGG + Intergenic
1191813681 X:65219025-65219047 CAGTGGAGCTACTAGTCTCCAGG - Intergenic
1191877385 X:65810198-65810220 CACTGGGGCTCTCTCTCTCAAGG - Intergenic
1193105691 X:77669379-77669401 CAGTGAGCCTCCCTCACTCCAGG - Intronic
1196251513 X:113465766-113465788 CAGTATGGCTCCATCTTTCCTGG + Intergenic
1196759296 X:119186944-119186966 TGCTGGGGCTCCTGCTCTCCTGG + Intergenic
1197366149 X:125567099-125567121 CATGGGGTCTCTTTCTCTCCAGG - Intergenic
1197371212 X:125628214-125628236 CAGTGGGGCTGCCTCACTCCAGG - Intergenic
1197728447 X:129791785-129791807 CAGTTGGGCTCCTTCTCCCTGGG - Intronic
1198260470 X:134960565-134960587 CAGAGGGGCCCCTTGCCTCCCGG - Intergenic
1198486747 X:137094991-137095013 CAGTGATGCTTCTTCTCTCTGGG + Intergenic