ID: 1121440745

View in Genome Browser
Species Human (GRCh38)
Location 14:93947589-93947611
Sequence AGCACAGCAGGCCCACCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121440745_1121440753 22 Left 1121440745 14:93947589-93947611 CCGCGTGGTGGGCCTGCTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1121440753 14:93947634-93947656 TTTAACAACGACCCTTAGGAAGG 0: 1
1: 0
2: 1
3: 4
4: 57
1121440745_1121440749 -4 Left 1121440745 14:93947589-93947611 CCGCGTGGTGGGCCTGCTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1121440749 14:93947608-93947630 TGCTAACCACGGTAATGCACGGG 0: 1
1: 0
2: 0
3: 0
4: 30
1121440745_1121440748 -5 Left 1121440745 14:93947589-93947611 CCGCGTGGTGGGCCTGCTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1121440748 14:93947607-93947629 GTGCTAACCACGGTAATGCACGG 0: 1
1: 0
2: 0
3: 4
4: 26
1121440745_1121440751 18 Left 1121440745 14:93947589-93947611 CCGCGTGGTGGGCCTGCTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1121440751 14:93947630-93947652 GACCTTTAACAACGACCCTTAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1121440745_1121440754 25 Left 1121440745 14:93947589-93947611 CCGCGTGGTGGGCCTGCTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1121440754 14:93947637-93947659 AACAACGACCCTTAGGAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121440745 Original CRISPR AGCACAGCAGGCCCACCACG CGG (reversed) Intronic
900481888 1:2903392-2903414 AGGGCAGGAGGCCCTCCACGCGG + Intergenic
902744442 1:18464098-18464120 ACCACAGCAGGCACACGACTGGG - Intergenic
904826288 1:33275945-33275967 AGCACAGCAGGCCTCCCACCAGG - Intronic
907872467 1:58455381-58455403 AGGATTGCAGGCCCACCCCGCGG + Intronic
915904515 1:159868024-159868046 AGAACAGCAGGCCCAGCCCAAGG + Intronic
1062843086 10:686334-686356 AGCACAGCCTTCCCCCCACGTGG + Intronic
1063578903 10:7287618-7287640 ATCACAGCCAGCCCTCCACGTGG + Intronic
1066112245 10:32207666-32207688 AGCCCAGCAGCCCCACCTGGTGG + Intergenic
1069150558 10:64954113-64954135 AGCCCAGCTCGCCCACCACCTGG - Intergenic
1069325237 10:67224988-67225010 AGCCCAGCTTGCCCACCACCTGG + Intronic
1070452891 10:76579663-76579685 AGGACAGCTGGGCCACCACCAGG + Intergenic
1073559192 10:104482261-104482283 TGCACAGCAGCCCCAGCAAGTGG - Intergenic
1074843041 10:117374537-117374559 AGCGCAGCCTTCCCACCACGCGG + Exonic
1076357974 10:129866733-129866755 AGAACAGCAGTGACACCACGGGG + Intronic
1083242526 11:61399591-61399613 AGGCCAGCAGGCAGACCACGAGG - Intergenic
1083437076 11:62649859-62649881 AGCACAGCAGCCCGAGCAGGTGG + Exonic
1083592583 11:63904224-63904246 AACACAGCAGGACCCCCAAGTGG - Intronic
1084769500 11:71333621-71333643 GGCACTGCTGGCCCACCAAGAGG + Intergenic
1084949371 11:72656313-72656335 AGCACAGCAGGCCCAATATCAGG + Intronic
1084979593 11:72822089-72822111 GGCGCAGCAGGCCCAGCAGGTGG + Exonic
1085517050 11:77117689-77117711 ACCGCAGCAGGCTCACCATGGGG + Intronic
1085747769 11:79129486-79129508 AGCCCAGCTCGCCCACCACCTGG + Intronic
1088170838 11:106994705-106994727 AGCACAGGAGACCCACGACCTGG - Intronic
1088388081 11:109281804-109281826 AGCTCAGCTTGCCCACCACCTGG - Intergenic
1088439212 11:109850099-109850121 GGCACAGCAGGCCTGCCTCGGGG - Intergenic
1090030348 11:123200924-123200946 AGCCCAGCAGGCCTTCCAGGAGG + Intergenic
1093014496 12:14142781-14142803 AGCAGGGCAGGACCACCACCTGG + Intergenic
1095454881 12:42372633-42372655 AGAACAGCAGGCCTAGAACGTGG - Intronic
1097278086 12:57826714-57826736 AGCACAGAAAGCCAGCCACGAGG - Intronic
1101307950 12:103548815-103548837 TTCACAGAATGCCCACCACGAGG - Intergenic
1104979759 12:132568591-132568613 GGCACAGGAGGCCCCGCACGTGG + Intronic
1105323414 13:19348048-19348070 AGGCCAGCAGGGCCAGCACGGGG - Intergenic
1105873974 13:24537789-24537811 AGGCCAGCAGGGCCAGCACGGGG + Intergenic
1113235677 13:108270138-108270160 AGAGCTGCAGGGCCACCACGCGG + Exonic
1113480768 13:110618993-110619015 GGCACAGCAGGGCCGCCTCGGGG - Intronic
1113561268 13:111283428-111283450 TACACAGAAGGCCCAGCACGTGG - Intronic
1115905565 14:38199318-38199340 TGGAGAGCAGGCCCATCACGGGG + Intergenic
1118444009 14:65835685-65835707 AGCCCAGCAGGACCAGCAAGAGG + Intergenic
1121216464 14:92252219-92252241 GGCCCAGCAGGACCACCACCCGG - Intergenic
1121440745 14:93947589-93947611 AGCACAGCAGGCCCACCACGCGG - Intronic
1121886666 14:97549429-97549451 AGCACAGGAATCCCACCAAGTGG - Intergenic
1123189418 14:106554122-106554144 TACGCAGCAGTCCCACCACGGGG + Intergenic
1123671909 15:22667094-22667116 GCCACAGCAGGCGCATCACGAGG - Intergenic
1128301209 15:66567457-66567479 CTCAGAGCAGGGCCACCACGAGG - Intergenic
1128977966 15:72167175-72167197 AGCCCAGCATGGCCACCATGGGG + Intronic
1130916907 15:88312308-88312330 AACAGAGCAGGCCCTCCAAGAGG - Intergenic
1132469963 16:97064-97086 TGCACAGCATGGCCACCAGGGGG - Intronic
1133096303 16:3448927-3448949 GGCACAGGATGACCACCACGTGG - Intronic
1135340060 16:21637653-21637675 GGCTCAGCAGGCCCAGCACTCGG - Intronic
1135929684 16:26726002-26726024 AGCACAGGAGCCCCAGCAGGTGG - Intergenic
1137858164 16:51817714-51817736 AGCCCAGCAGTCCCACTACTGGG - Intergenic
1139298695 16:65925556-65925578 ACCACACCCGGCCCACCACCCGG - Intergenic
1139545081 16:67646248-67646270 GGAACAGCTGGCCCAGCACGTGG + Exonic
1142411595 16:89919810-89919832 GGCACAGCAGGACGGCCACGTGG - Exonic
1144848094 17:18230496-18230518 AGCACAGCACGGCCCCCACCTGG + Intronic
1145206451 17:20986789-20986811 AGCACAGCAATCCCATCACTGGG + Intergenic
1147264695 17:39227565-39227587 AGCACCTCAGGCCCCCCATGTGG - Intergenic
1147559660 17:41501096-41501118 AGCACAGAGGGCCCACCATCAGG + Exonic
1147586629 17:41656884-41656906 TGCACAGCAGGGCCACCAGCAGG - Intergenic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1152341682 17:79729191-79729213 TGCAGAGCAGGCACCCCACGCGG + Intergenic
1152552900 17:81038678-81038700 AGCACATGACGCCCACCACCTGG - Intronic
1152569075 17:81113555-81113577 GGGACAGCAGGCCCACAAGGAGG - Intronic
1153909770 18:9696557-9696579 AACAGAGAAGGCCCACCACCGGG - Intergenic
1153992736 18:10414576-10414598 CGCCCACCACGCCCACCACGTGG + Intergenic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1161948445 19:7453666-7453688 AGCATAGCATGCCCTCCAGGTGG - Exonic
1161978727 19:7619801-7619823 GGCACAGCAGGTCAACCCCGAGG - Exonic
1162421200 19:10567057-10567079 ATCACAGCGGGGCCACCATGTGG + Exonic
1164919585 19:32078934-32078956 AGCACAGCAGGGCCAGGAAGAGG + Intergenic
925646638 2:6043601-6043623 AGCACAGCAGGTCTACAAAGAGG + Intergenic
927868569 2:26608838-26608860 AGCACATCACCCCCACCCCGGGG + Intronic
931823419 2:65975166-65975188 AGCAAAGCAGGCCCAGGAAGGGG + Intergenic
932731023 2:74222078-74222100 GGCACAGCACAACCACCACGAGG + Intronic
933687777 2:85157223-85157245 AGCATAGCAGGCCCAGAACTTGG + Intronic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
935279053 2:101502151-101502173 AGCCCAGCCTGCCAACCACGTGG + Intergenic
938072175 2:128314549-128314571 AGGAGAGCAGGCACACCAGGTGG + Intronic
944410782 2:199440250-199440272 AGGACAGCAGGGCCACAAAGAGG - Intronic
946193007 2:218017308-218017330 AGCAGAGCAGGCCCAGCCCCAGG + Intergenic
946246654 2:218391534-218391556 AGGACAGCAGGCACACTACTGGG + Intronic
948626995 2:239275552-239275574 AGCAATGCAGGGCCGCCACGAGG + Intronic
948834609 2:240620122-240620144 AGCACCCAAGGCCCACCCCGAGG + Intronic
948850764 2:240704287-240704309 AGCAGAGTCGTCCCACCACGGGG + Intergenic
1170916855 20:20634857-20634879 AGCACAACAGGCCCCACACAAGG + Intronic
1171179410 20:23081545-23081567 TGCACACCACTCCCACCACGGGG - Exonic
1172930943 20:38586137-38586159 GGCACAGCAGGCTCACCAGCAGG - Exonic
1174447738 20:50602033-50602055 AGCAAAGCAGGGCCACCGCCCGG + Intronic
1175494415 20:59403875-59403897 TGCACAACAGCGCCACCACGAGG + Intergenic
1176083946 20:63287421-63287443 TCCACAGCAGCCCCACCAGGTGG - Intronic
1176215186 20:63944529-63944551 AGCCCAGCAGGCTCACCTCTGGG + Exonic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176308227 21:5135487-5135509 AGCACAGCAGACCCACTCCTGGG - Intronic
1179588473 21:42389217-42389239 GGCACAGCAGCCCCACCCCTTGG - Intronic
1179848833 21:44126545-44126567 AGCACAGCAGACCCACTCCTGGG + Intronic
1180187670 21:46147553-46147575 AGCAAAGCAGCCTCACCACAAGG + Intronic
1181600761 22:23950527-23950549 GGCACAGCAGGCACAGAACGAGG + Intergenic
1181607751 22:23990792-23990814 GGCACAGCAGGCACAGAACGAGG - Intergenic
1183469768 22:37999088-37999110 TGCCCAGCAGGCCCACCTCGGGG - Intronic
1185364777 22:50432462-50432484 TGCACAGCAGCCCCAGAACGTGG - Intronic
950764060 3:15260284-15260306 AGCACAGCAAGGCCACCACTAGG + Intronic
952702528 3:36341864-36341886 AGCCCAGAAGGCCCACCATCTGG - Intergenic
957771320 3:84696030-84696052 GCCAAAGCAGGCCCACCACGTGG + Intergenic
959026363 3:101244268-101244290 GGCACAGCAGGCCCACTAAGAGG + Exonic
960842662 3:121976094-121976116 AGTGCAGCAGCCCCACCAAGGGG - Intergenic
964345200 3:155748129-155748151 AGCACAGCAGGCTCACCACAAGG - Intergenic
968445668 4:650953-650975 AGCCCAGCAGCCCCACCCTGAGG - Intronic
969534297 4:7746499-7746521 AGCACAGCAGGCCGTCCGCTGGG - Intergenic
971330863 4:25680340-25680362 AGCACAGCTGGCCTACAAAGAGG - Intergenic
972247388 4:37259678-37259700 AGGACAGCAGGATCCCCACGGGG + Intronic
974146055 4:57948927-57948949 AACAAAGCAGGCCTACCAAGTGG + Intergenic
974974923 4:68880028-68880050 AACAAAGAAGGCCCACCACAGGG + Intergenic
982267099 4:153548076-153548098 CCCACAGCAGGTCCACCACAGGG - Intronic
983328811 4:166296795-166296817 AGAACAGAAGGCCCAAGACGTGG + Intergenic
985575845 5:673234-673256 AGAGGAGCAGGGCCACCACGAGG - Intronic
985753878 5:1701422-1701444 AGCACAGCAGGCCGACTCTGCGG - Intergenic
988605210 5:32673380-32673402 GGCCCAGCAGGCCCAGCACTTGG - Intergenic
989804722 5:45588830-45588852 AGCTCAGCATGCCCAGCAAGTGG - Intronic
990665152 5:58063521-58063543 AGCAGAGCAGACCCACCCCTGGG - Intergenic
997581020 5:135017092-135017114 AGTACAGCAGGCCCACATGGTGG + Intergenic
998393870 5:141805872-141805894 GGCACAGCAGTCCCTCCCCGAGG + Intergenic
1000045647 5:157519887-157519909 AGCACTCCAAGCCCACCACCAGG - Exonic
1000066102 5:157694215-157694237 AGGAGTGCAGGCGCACCACGCGG + Intergenic
1001654412 5:173338578-173338600 AGCACTGGAGGCCCAGCATGTGG + Intergenic
1005810168 6:29509319-29509341 AGCCAAGCAGGCCCACCCCAGGG + Intergenic
1012525166 6:100168838-100168860 AGCATAGCAGGCCCAAGAAGTGG + Intergenic
1013014173 6:106146087-106146109 AGCACAGCAGGCAGACGTCGGGG - Intergenic
1018827055 6:167416044-167416066 AGCCCACCAGCCCCCCCACGCGG - Intergenic
1019884667 7:3893357-3893379 AGCATAGCAAGCCAACCGCGGGG - Intronic
1019905158 7:4057001-4057023 TGCCCAGCAGCCCCACCACTGGG - Intronic
1020426280 7:8069504-8069526 AGCACAGCTGCCCCACCCCCTGG - Intronic
1023900021 7:44468659-44468681 AACACAGCAGGCCCAGCTCTTGG + Intronic
1023965924 7:44963034-44963056 AGCGGTGCAGGCACACCACGAGG + Exonic
1024319378 7:48049913-48049935 AGCAAAGCAGGCACCCCACTTGG + Exonic
1029513914 7:101014091-101014113 AGCACCGCAGGCCCACACAGAGG + Intronic
1029524710 7:101087744-101087766 AGCCCACCAGGTCCACCACGCGG - Exonic
1030965226 7:115984362-115984384 TGCACAAGAGGCCCACCACTTGG + Exonic
1031926759 7:127646307-127646329 AGCATAGCACCCTCACCACGTGG - Intergenic
1033949664 7:146768493-146768515 AGCACAGCAGTTCCTCCAAGAGG - Intronic
1034140178 7:148808176-148808198 AGCACAAGAAGCCCACCATGGGG + Intronic
1034269966 7:149798687-149798709 AGGACAGCAGGCCCTCCAGGAGG - Intergenic
1034741569 7:153478711-153478733 TGCACAGCAGCCCCACTACAGGG - Intergenic
1036445700 8:8820260-8820282 AGCACAGCAGTCCCAACCCTGGG - Intronic
1037910721 8:22742115-22742137 AGGACACCAGGCCCACCCCTAGG + Intronic
1040560968 8:48523310-48523332 AGCCCTGCAGGGCCACCACGGGG - Intergenic
1040605428 8:48927082-48927104 AGCAAGGCAGGCACACCACATGG - Intergenic
1048808636 8:138264375-138264397 TGCACAGCAGGACCATCATGAGG + Intronic
1049009800 8:139879652-139879674 AGGACAGCAGGGCCAACACAGGG - Intronic
1049476575 8:142799717-142799739 CCCACAGCAGGCCCTCCACGGGG + Intergenic
1057376185 9:94525385-94525407 ACCACACCCGGCCCACCCCGGGG - Intergenic
1057563934 9:96151723-96151745 AGCACAGCAGGCACTCCAGTAGG + Intergenic
1061822764 9:133237794-133237816 AGCCCAGCTGGCCCATCACAGGG + Intergenic
1062085797 9:134647545-134647567 AACACACCAGGCCCTGCACGTGG - Intronic
1062109307 9:134773290-134773312 AGCCCAGCAGGCCCCGCAGGAGG - Intronic
1062206243 9:135339006-135339028 AGCACAGCCTGCCCACCGCAGGG + Intergenic
1062380974 9:136286328-136286350 AGCGCAGCAGGCCCACAGCTGGG + Exonic
1185462128 X:338322-338344 CGCACATCAGGCCCAGCACGGGG - Intronic
1190691394 X:52916118-52916140 AGCACAGCCTCCTCACCACGAGG - Intergenic
1190694589 X:52939674-52939696 AGCACAGCCTCCTCACCACGAGG + Intronic
1191053850 X:56222588-56222610 AGGAGTGCAGGCCCACCATGTGG - Intergenic
1192718679 X:73669438-73669460 AGCTCAGCAGTTCCACCATGTGG - Intronic
1193644241 X:84047443-84047465 TGCACTGCAGGCTCACCACCAGG + Intergenic
1200398474 X:156005271-156005293 CCCACAGCAGGCCCAGCACAGGG + Exonic