ID: 1121440978

View in Genome Browser
Species Human (GRCh38)
Location 14:93949121-93949143
Sequence ATGTCCTTCCAGAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121440978_1121440982 7 Left 1121440978 14:93949121-93949143 CCTTCCTTGTTCTGGAAGGACAT 0: 1
1: 0
2: 2
3: 10
4: 267
Right 1121440982 14:93949151-93949173 AGATGCTTGAAGATGTCAGTGGG 0: 1
1: 1
2: 1
3: 29
4: 191
1121440978_1121440983 8 Left 1121440978 14:93949121-93949143 CCTTCCTTGTTCTGGAAGGACAT 0: 1
1: 0
2: 2
3: 10
4: 267
Right 1121440983 14:93949152-93949174 GATGCTTGAAGATGTCAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 178
1121440978_1121440981 6 Left 1121440978 14:93949121-93949143 CCTTCCTTGTTCTGGAAGGACAT 0: 1
1: 0
2: 2
3: 10
4: 267
Right 1121440981 14:93949150-93949172 AAGATGCTTGAAGATGTCAGTGG 0: 1
1: 0
2: 0
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121440978 Original CRISPR ATGTCCTTCCAGAACAAGGA AGG (reversed) Intronic
900209668 1:1448179-1448201 AAGTACTTACAGAACCAGGAAGG - Intergenic
900219656 1:1500999-1501021 AAGTACTTACAGAACCAGGAAGG - Intergenic
900477182 1:2881526-2881548 ATGTCCTTCCAAGGCAACGAAGG - Intergenic
900534838 1:3171714-3171736 GGGTCCTTCCAGAAAGAGGAAGG - Intronic
900800393 1:4733601-4733623 CCATTCTTCCAGAACAAGGAGGG - Intronic
901408953 1:9069533-9069555 CTGCCCTTCCAGAGCAAGCATGG - Exonic
901693270 1:10988172-10988194 CTCTCCTTCCAGGGCAAGGATGG - Intergenic
904033225 1:27546047-27546069 ATGGCCTCCCAGAGCACGGATGG + Intronic
904571268 1:31467551-31467573 AAGTACTTACAGAACCAGGAAGG - Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908128897 1:61054872-61054894 AGGTGTTTCCAGAACAAGGTAGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909852116 1:80480528-80480550 ATGTAATTCCAGAACAAAAATGG - Intergenic
911751882 1:101504912-101504934 AAGTACTTACAGAACCAGGAAGG + Intergenic
913170152 1:116224777-116224799 ATGTCTTCCAAGACCAAGGAGGG + Intergenic
914814054 1:151050111-151050133 CTGTCCTTCCAGGACAAGGAAGG + Intronic
914922418 1:151856464-151856486 CCATCCTTCCAGATCAAGGATGG - Intergenic
916566547 1:165983845-165983867 ATGTGCTTCCAAAACAATGCTGG + Intergenic
917209469 1:172616675-172616697 CTGTCCATCCAGAAAAAGGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919757816 1:201076843-201076865 TTGTCCTTCAAGATCAAGGTGGG - Intronic
922201940 1:223411163-223411185 ATGACATTCCAGACCTAGGAAGG - Intergenic
922600512 1:226848068-226848090 ACTTGCTTCCAAAACAAGGAAGG + Intergenic
922626111 1:227045130-227045152 TAGTTCTACCAGAACAAGGAAGG - Intronic
923026795 1:230210901-230210923 TTGTTCTTCCAGAATAAGAATGG - Intronic
923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG + Intronic
924072984 1:240301602-240301624 ATGTCCTTCAAAAAAAAGGAAGG - Intronic
924609039 1:245558595-245558617 AGGTCCCTCCTGGACAAGGAAGG + Intronic
924621009 1:245660697-245660719 AGGTGCTTACAGAACAAGAAGGG - Intronic
1064097592 10:12435419-12435441 AGGCCCTTCCAAAACAAGCAGGG - Intronic
1065377460 10:25058119-25058141 AAGACCTTCCTGAACCAGGAAGG - Intronic
1067035786 10:42915541-42915563 ATACCCTTCAAGAAAAAGGAAGG - Intergenic
1069686077 10:70319675-70319697 ATGTCATTTCTGAAGAAGGAGGG - Intronic
1069912384 10:71767477-71767499 ATGTCCTGTGAGACCAAGGACGG - Intronic
1070373592 10:75808405-75808427 ATATGGTTCCAGAAAAAGGAAGG + Intronic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1071213690 10:83373921-83373943 ATGTCCTTGTTTAACAAGGATGG - Intergenic
1071280294 10:84095395-84095417 TGGCCCTTCCAGAAAAAGGAAGG - Intergenic
1072269038 10:93757375-93757397 CTCTCCTTCCATGACAAGGAAGG - Intergenic
1076180409 10:128402731-128402753 ATTTCCTTGCAGATCAAAGATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079544562 11:21617191-21617213 AAGTCCTTTGAGAACAAGGTGGG - Intergenic
1079818347 11:25091973-25091995 ATTTCCTTCCAAAACACAGAGGG + Intergenic
1080952726 11:37054654-37054676 AAATCCTTCCTGAAAAAGGAAGG - Intergenic
1081033684 11:38115715-38115737 AAGTACTTACAGAATAAGGAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1086987307 11:93264274-93264296 AAGTACTTACAGAACCAGGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087284874 11:96254707-96254729 AAGTCGTTCCAGAGCAAAGATGG + Intronic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087777596 11:102270514-102270536 ATTTCCTTCCAGCTCTAGGAGGG + Intergenic
1088107915 11:106226676-106226698 AAGTGCTTACAGAACCAGGAGGG + Intergenic
1088390190 11:109305533-109305555 ATGTTCTTCCAAAACAAAAAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091465641 12:681680-681702 ATTTCCTTCCAGTACATGGTAGG + Intergenic
1093110546 12:15146480-15146502 ATGTCCTTGCAAAATAAGGTCGG + Intronic
1093356595 12:18174670-18174692 AAGTACTTACAGAACCAGGAAGG + Intronic
1094794148 12:33950952-33950974 GTGTCCTTCCAGCACCAGGCTGG - Intergenic
1095511385 12:42954656-42954678 ATGTCCTGCCAAAACAAGAGAGG - Intergenic
1096293570 12:50363360-50363382 ATGTCCTGTCAGAATAAGAAGGG + Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099435669 12:82642466-82642488 ATGTCTTTGCAGGACATGGATGG + Intergenic
1100036440 12:90258205-90258227 TTGTGCTTCCTAAACAAGGAGGG - Intergenic
1100050636 12:90444866-90444888 AAGTACTTACAGAATAAGGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102606181 12:114069183-114069205 AAGTACTTACAGAACCAGGAAGG + Intergenic
1103406638 12:120680541-120680563 ATGACCTTCCACAGCAGGGAGGG + Intergenic
1104461145 12:128957159-128957181 ATTTCCTTCCAGCACAGGCAAGG - Intronic
1106957642 13:34958945-34958967 ATATCCTTACAGAAAAAGAAAGG - Intronic
1111644922 13:91020463-91020485 CTGTCTTACCAGAATAAGGAAGG + Intergenic
1112979432 13:105363774-105363796 CTGTTCTTCCAGAAACAGGAAGG + Intergenic
1113036973 13:106061614-106061636 AGGTCCTTACAGAACAAGCAAGG - Intergenic
1113506233 13:110818396-110818418 ATGTCCTTCCTGAAGAACAAGGG + Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114010001 14:18356545-18356567 AAGTACTTGCAGAACTAGGAAGG + Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116725723 14:48559370-48559392 AAGTACTTACAGAACCAGGAAGG + Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1119749023 14:77064583-77064605 TCTTCCTTCTAGAACAAGGAAGG + Intergenic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122382540 14:101319127-101319149 AAGTACTTACAGAACCAGGAAGG + Intergenic
1122434399 14:101684525-101684547 ACTTGCTTCCAGCACAAGGAAGG - Intergenic
1122717994 14:103706836-103706858 CGCTCCTTCCAGAACAGGGAGGG - Intronic
1125690124 15:41589277-41589299 AAGTACTTACAGAACCAGGAAGG + Intergenic
1125929790 15:43592468-43592490 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1125942957 15:43692300-43692322 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1127785762 15:62353412-62353434 CTGGGCTTCCAGAACAAGCAGGG + Intergenic
1129777124 15:78244088-78244110 CTGGACTTCCAGAACAAGGGAGG + Intronic
1141265222 16:82490405-82490427 AGGTCCTTCCAGGCTAAGGAAGG + Intergenic
1146361658 17:32181015-32181037 AATTCCTACCAGAACCAGGAGGG - Intronic
1146658631 17:34649992-34650014 ATTTCCTTCCAGCAGAAGGACGG - Intergenic
1148776887 17:50101032-50101054 ATGTGCTTCCAGAAAATGCAGGG + Intronic
1150475358 17:65470825-65470847 AGGGCCTCCCAAAACAAGGAGGG - Intergenic
1151383857 17:73743363-73743385 ATGTTCTTCTTCAACAAGGAGGG + Intergenic
1151682966 17:75631333-75631355 ATGTCCTACCAGCTCAAGGGGGG + Intronic
1152204469 17:78967248-78967270 GTGTCCTTCCAGCTCATGGAGGG - Intergenic
1153017135 18:594045-594067 ATGTCCTCCAGGAACAAAGAGGG - Intergenic
1155351791 18:24914279-24914301 TAGTCCTTCCTGAACAAGGGAGG + Intergenic
1155693538 18:28655707-28655729 ATCTCAATCCAGAATAAGGATGG - Intergenic
1156404985 18:36775032-36775054 ACGTCCACTCAGAACAAGGAGGG + Intronic
1156711186 18:39947881-39947903 ATGACTTTCCATAACAAGTATGG - Intergenic
1156763623 18:40624720-40624742 ATATCCTTAGAAAACAAGGAGGG - Intergenic
1157434516 18:47657252-47657274 ATATCCTTCAAAAACAAAGATGG + Intergenic
1157470351 18:47983561-47983583 CTCTTCTCCCAGAACAAGGAGGG - Intergenic
1157647149 18:49286433-49286455 ATGTCCTTCAAGAACACACAAGG - Exonic
1158640938 18:59203022-59203044 AGGTCCATCCTGAAAAAGGAAGG - Intergenic
1160069434 18:75612425-75612447 ATGGACTTCCAGAAAAAAGAAGG + Intergenic
1161936472 19:7375603-7375625 GGGCCCTTCCAGGACAAGGAAGG - Intronic
1162007080 19:7787852-7787874 GTGCCCTGGCAGAACAAGGACGG - Intergenic
1162854877 19:13460588-13460610 AAGTCCTTCCAGCACCAGCAAGG + Intronic
1166929364 19:46292408-46292430 ATGAAATTCCAGAACAAGTAAGG - Intergenic
926503221 2:13680011-13680033 AAGTACTTACAGAACCAGGAAGG + Intergenic
926705366 2:15833814-15833836 GTGTCCTTCCAAAGCATGGAAGG - Intergenic
928347975 2:30518454-30518476 AAGTACTTACAGAACCAGGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928437066 2:31261588-31261610 TTGTCCTTCCCGAACACCGAGGG - Exonic
929083776 2:38147939-38147961 ATGTCCTTTCGCAACATGGATGG + Intergenic
933389669 2:81653827-81653849 AAGTACTTACAGAACCAGGAAGG - Intergenic
933615642 2:84479797-84479819 TTGTCCTTCAAGAACAAGGGGGG - Intergenic
935830765 2:106998828-106998850 AGGCCATTCCAGAAAAAGGAGGG - Intergenic
937107253 2:119328162-119328184 AGATTCTTCCAGAAGAAGGATGG - Intronic
937411496 2:121680767-121680789 AAGTACTTACAGAACCAGGAAGG - Intergenic
939527888 2:143320230-143320252 AAGTCCTACCAGACAAAGGAGGG + Intronic
939829636 2:147056641-147056663 ATATCCTAGCAGGACAAGGAAGG - Intergenic
941474214 2:165928396-165928418 ATGGACTTCCAGAATAAGGGAGG + Intronic
943214479 2:185013000-185013022 CTGTCCTTCCTGAAATAGGAAGG - Intergenic
943518868 2:188922460-188922482 ATGCACTTCCAGCACAATGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944189785 2:196990823-196990845 TTCTCCTTCCAGTACAATGATGG - Intronic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
946797953 2:223376136-223376158 TTCTCCTTCCATATCAAGGAGGG - Intergenic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
948333869 2:237192981-237193003 ATGCCCTGCCAGGGCAAGGAAGG + Intergenic
1168823019 20:789291-789313 AAGTACTTACAGAACCAGGAAGG - Intergenic
1169055889 20:2620712-2620734 CTATCCTTCAAGAAGAAGGAAGG + Intronic
1175711731 20:61226807-61226829 ATGTGCTCCCAGAACAGGGGAGG + Intergenic
1175720665 20:61284982-61285004 GTGTCCTTACAGAGCAGGGAGGG - Intronic
1175823305 20:61923532-61923554 ATGTCCTTCCAGTCCACGGCAGG + Exonic
1177803535 21:25851470-25851492 ATGTCCTTCTGGAGCAAAGAAGG + Intergenic
1178910134 21:36667598-36667620 AGATCCTGCCAGAACAAGGGTGG - Intergenic
1179530538 21:42015672-42015694 CTGCTCTTCAAGAACAAGGATGG - Intergenic
1180434499 22:15287354-15287376 AAGTACTTGCAGAACTAGGAAGG + Intergenic
1182410022 22:30176865-30176887 AAATTCTTCCAGAATAAGGAGGG - Exonic
1182671074 22:31996573-31996595 ATATGGTTTCAGAACAAGGAAGG + Intergenic
950090246 3:10289919-10289941 ATGTCCTTCCAGAAACAGTGAGG + Intronic
950594749 3:13969820-13969842 AAGTACTTACAGAACCAGGAAGG - Intronic
950846347 3:16019496-16019518 AAGTACTTACAGAACCAGGAAGG - Intergenic
950920461 3:16689055-16689077 ATAGCATTCCAGGACAAGGAGGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951840298 3:27026991-27027013 ATGTCCTTCCATAATAGGGTTGG + Intergenic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
953574753 3:44104083-44104105 GTTTCTGTCCAGAACAAGGATGG + Intergenic
956042753 3:65162876-65162898 ATGTTAGTCCAGAAAAAGGATGG - Intergenic
957497055 3:81006380-81006402 ATTTACTAACAGAACAAGGAGGG - Intergenic
958083267 3:88774068-88774090 ATTTCCTTCCAGGACATGGTAGG - Intergenic
959790169 3:110350736-110350758 ATGTCATTGCAGCAAAAGGAAGG + Intergenic
960720497 3:120620856-120620878 AAGTACTTACAGAACCAGGAAGG - Intergenic
961706461 3:128790120-128790142 ATGTTCTCCCAGATCAAGAATGG - Intronic
962473477 3:135734806-135734828 ATGTCCTTCCAGGTGAAGGTGGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967258249 3:187615289-187615311 ATATCCTTTCAGTATAAGGAAGG - Intergenic
967411598 3:189171841-189171863 GTGTCATTGCAGAACAAGAAAGG + Intronic
967712226 3:192722568-192722590 GTGTGATTCCAGAACATGGAAGG - Intronic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
969204232 4:5630498-5630520 CTGTCCTTCTAGCACAAGTAGGG + Intronic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
969855027 4:9992126-9992148 AACTCCTCCCAGAAGAAGGATGG - Intronic
970092808 4:12429187-12429209 ATGTACTTAGAGAACCAGGAAGG - Intergenic
970922996 4:21417026-21417048 ATTTCCTTACAAAACACGGAAGG - Intronic
970990938 4:22212380-22212402 ATTTCCTTCTTGAATAAGGAGGG - Intergenic
971903915 4:32700760-32700782 ATATCCTAATAGAACAAGGAAGG + Intergenic
972830936 4:42812827-42812849 GTGTTCTTCCAGACCAAGAAAGG - Intergenic
974294088 4:59971976-59971998 ATGGCATTTCAGAACAATGAAGG + Intergenic
975506029 4:75138705-75138727 AGTTCTTTCCAGAACAAGGAAGG - Intergenic
975559750 4:75698093-75698115 ATTTCCTTACAGAACAAAAAGGG + Intronic
976219049 4:82741377-82741399 GTTTCCTTTCAGAACAAGCATGG - Intronic
976835870 4:89372793-89372815 ATAGAATTCCAGAACAAGGAAGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
980438943 4:132816468-132816490 AAGTACTTACAGAACCAGGAAGG - Intergenic
982311237 4:153987478-153987500 ATGTCCATACATAACAATGAGGG + Intergenic
983185366 4:164694604-164694626 AAGGCTTTCCAGCACAAGGAAGG + Intergenic
987024797 5:13914894-13914916 ATGTCTTAACAAAACAAGGAAGG + Intronic
988995092 5:36707111-36707133 ATTTCTTTCCATAACAATGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989613736 5:43319161-43319183 AAGTACTTACAGAACCAGGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992578502 5:78145870-78145892 CTCTCCTTCCAGAAGAAAGATGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
994787329 5:104181200-104181222 ATGTCCTTACAGCCAAAGGAGGG + Intergenic
995131653 5:108636808-108636830 GTGTTCTTCCTTAACAAGGAGGG + Intergenic
995393804 5:111666599-111666621 CTGTCCTTCCCAAAAAAGGAAGG + Intronic
996443765 5:123520320-123520342 ATATTCTTCCAGAAGATGGATGG - Intronic
996830234 5:127732681-127732703 TTGTCCTTCAGGAACATGGATGG + Intergenic
996924597 5:128809547-128809569 TTATCCTTCCAGCAGAAGGAGGG - Intronic
997385651 5:133470029-133470051 ATGCCCTTCCAGAGTATGGAAGG - Intronic
997743241 5:136276275-136276297 ATGTGCTTCCAGAGCATGGCTGG + Intronic
998302614 5:141039683-141039705 ATGCCCCTCCAGAATGAGGAGGG + Intergenic
999084241 5:148873014-148873036 ATGGTCTTCAAGAACATGGAGGG + Intergenic
1001030903 5:168262092-168262114 CTGTCCTTCCAGAGCCATGAAGG - Exonic
1001053528 5:168431270-168431292 TTGTGCTTTCAGAGCAAGGAAGG - Exonic
1001642328 5:173253225-173253247 ATGACCTTCAAGGGCAAGGAGGG + Intergenic
1004477367 6:15986359-15986381 AGGTCCTTCTACAACAAGGTTGG - Intergenic
1004812718 6:19277252-19277274 AAGTCCTTACAGAATCAGGAAGG + Intergenic
1005189200 6:23200515-23200537 TTGTCCTCCCAGAAAAATGAGGG - Intergenic
1005854826 6:29852848-29852870 ATGTCCTTCCAGGACTGGGCTGG + Intergenic
1007700271 6:43762317-43762339 ATCTCCTTCCAGAACACAGCTGG - Intergenic
1008221932 6:48864601-48864623 AAGTGGTTTCAGAACAAGGAGGG + Intergenic
1009335254 6:62480390-62480412 TTGTCCTTCAAGAAAGAGGATGG + Intergenic
1009764144 6:68047588-68047610 ATATTTTTCCAGAACATGGATGG + Intergenic
1010422423 6:75690353-75690375 ATTTCCTTCCTTAAAAAGGAAGG + Intronic
1012888955 6:104877458-104877480 ATTTCCTTCCAGAAACAGGGTGG - Intergenic
1014865802 6:126528538-126528560 AGATCCTTCCAGAATAAGGTAGG - Intergenic
1015881103 6:137870690-137870712 CTGTCCTTCCAGCATAGGGAGGG + Intronic
1016698918 6:147031895-147031917 ATGTCTTTCAGGAACATGGATGG + Intergenic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019759000 7:2795037-2795059 ATGGCCTTCGAGAACAAGGCGGG - Exonic
1020110555 7:5445636-5445658 GTGTCCTTCCAAGAAAAGGAGGG + Intronic
1020745226 7:12071445-12071467 AAGTACTTTCAGAACCAGGAAGG + Intergenic
1021667106 7:22994930-22994952 TCGTCCTTCCAGAATTAGGATGG - Intronic
1022195200 7:28058497-28058519 TTGGCCTTCCTGTACAAGGAAGG + Intronic
1025953518 7:66164852-66164874 ATGGCTTTCCAGAAAAAGCAGGG - Intergenic
1028315015 7:89390729-89390751 ATGTCTTTTCAGTACTAGGAGGG + Intergenic
1028977960 7:96934977-96934999 ATGTCCTGCCAAAATAAGGGGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030084096 7:105802550-105802572 ATGTCCTTCCAGAGCATAGTAGG - Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032696880 7:134344826-134344848 TTGTCCTTCCAAAGCAGGGAGGG - Intergenic
1033454358 7:141489259-141489281 ATGGGCTTCCAGATCAAGGCTGG - Intergenic
1034076019 7:148231864-148231886 ATGCAGTTCCAGAAAAAGGAAGG + Intronic
1034387418 7:150752151-150752173 ATTACCTTCCAGAACATAGAGGG + Intergenic
1034611186 7:152370465-152370487 AATCCCTTCCAGAAAAAGGAGGG + Intronic
1034916060 7:155040055-155040077 ATGACCTACCAGAACTAGTAAGG + Intergenic
1035235548 7:157495597-157495619 AGATCCCTCCGGAACAAGGATGG + Intergenic
1036104612 8:5826382-5826404 AAGTACTTGCAGAACCAGGAAGG - Intergenic
1038523127 8:28250355-28250377 ATCTCCTTCCAGAGCAAGTCAGG + Intergenic
1038648963 8:29385233-29385255 ATTTCCTTCCTTAAAAAGGAAGG + Intergenic
1038945573 8:32355883-32355905 ATGGTCTTCCAGATGAAGGAGGG + Intronic
1041942125 8:63399947-63399969 ATGTCCTTCCAGAAAGAGGAAGG + Intergenic
1042088064 8:65130447-65130469 AAGTACTTACAGAACCAGGAAGG - Intergenic
1042490338 8:69390641-69390663 ATGACCTTCCTCAAGAAGGAGGG - Intergenic
1043267902 8:78289524-78289546 ATTTATTTCCAGAACAATGAGGG + Intergenic
1044649413 8:94478754-94478776 TGGTCCTTCCAGAACAAGTTAGG - Intergenic
1047229523 8:122984553-122984575 ATGTCCTTTCAGAAAGATGAGGG + Intergenic
1049043290 8:140129181-140129203 ATCTCCTTTCTGAACAAGGCAGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052507934 9:29379077-29379099 AGGTCCTACCAGACCTAGGAGGG + Intergenic
1053705619 9:40750140-40750162 AAGTACTTGCAGAACCAGGAAGG - Intergenic
1054415696 9:64873747-64873769 AAGTACTTGCAGAACCAGGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056390016 9:86132217-86132239 ATGCCAGTCCATAACAAGGATGG + Intergenic
1056414590 9:86364255-86364277 AAGTACTTACAGAACAAGGAAGG - Intergenic
1057412126 9:94826158-94826180 ATGTCTTCGGAGAACAAGGAGGG - Intronic
1058300476 9:103365294-103365316 TTGTCATTCAATAACAAGGATGG + Intergenic
1059343407 9:113612472-113612494 AAGTCCTTCCAGAAACTGGAGGG - Intergenic
1059358540 9:113720184-113720206 TTGTCCTTCCAAAGGAAGGAAGG - Intergenic
1061187086 9:129060965-129060987 ATGTCCTCCCATCCCAAGGAAGG - Intronic
1061612296 9:131755190-131755212 GTCTTCTCCCAGAACAAGGAGGG + Intergenic
1062321583 9:135992951-135992973 TTGTCCCTCCAGAAAAAGAAGGG - Intergenic
1186096059 X:6103342-6103364 CTTTCCTTCCAGAAAATGGAGGG - Intronic
1186345616 X:8689312-8689334 ATGTCCTTCTAGAGCAACAATGG + Intronic
1186642765 X:11473462-11473484 GTGTCCTTACAGAAAAAGGAGGG + Intronic
1187287316 X:17917869-17917891 TTGTCCTTCCTGTACAAGTAAGG - Intergenic
1189034422 X:37480915-37480937 AAGTACTTACAGAACCAGGAAGG + Intronic
1189499764 X:41545601-41545623 ATGCTCTTGAAGAACAAGGAAGG - Intronic
1189834028 X:45003088-45003110 AAGTACTTACAGAACCAGGAAGG - Intronic
1193510638 X:82395248-82395270 ATGTCCTTCCATAGCTCGGAAGG + Intergenic
1194445765 X:93986064-93986086 ATGTCATTCCAGAAAAAAGGGGG - Intergenic
1195332924 X:103820508-103820530 TAGTCCTTCCAGAAACAGGAAGG - Intergenic
1195847040 X:109240123-109240145 AAGTACTTACAGAACCAGGAAGG - Intergenic
1199305609 X:146264058-146264080 ATGTCATGACAGAAAAAGGAGGG + Intergenic
1199377401 X:147129894-147129916 ACTTCCTTCCAACACAAGGAAGG + Intergenic
1200711594 Y:6489614-6489636 ATGTACTTACAGAATCAGGAAGG + Intergenic
1200763419 Y:7060730-7060752 AAGTACTTACAGAACCAGGAAGG - Intronic
1201022339 Y:9672365-9672387 ATGTACTTACAGAATCAGGAAGG - Intergenic