ID: 1121441847

View in Genome Browser
Species Human (GRCh38)
Location 14:93954483-93954505
Sequence GACCCACTCCTTCCTCTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121441847_1121441854 10 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441854 14:93954516-93954538 GTCAGGCCAAGGCCAGGCCAGGG 0: 1
1: 0
2: 4
3: 96
4: 757
1121441847_1121441852 4 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441852 14:93954510-93954532 CTCAAGGTCAGGCCAAGGCCAGG 0: 1
1: 0
2: 5
3: 23
4: 253
1121441847_1121441859 25 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441859 14:93954531-93954553 GGCCAGGGGGCCTCTCTCTCAGG 0: 1
1: 0
2: 5
3: 25
4: 285
1121441847_1121441850 -1 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441850 14:93954505-93954527 CAGTCCTCAAGGTCAGGCCAAGG 0: 1
1: 0
2: 3
3: 21
4: 207
1121441847_1121441856 12 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441856 14:93954518-93954540 CAGGCCAAGGCCAGGCCAGGGGG 0: 1
1: 0
2: 7
3: 120
4: 921
1121441847_1121441849 -7 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441849 14:93954499-93954521 GTGGGTCAGTCCTCAAGGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1121441847_1121441853 9 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441853 14:93954515-93954537 GGTCAGGCCAAGGCCAGGCCAGG 0: 1
1: 1
2: 6
3: 103
4: 1088
1121441847_1121441855 11 Left 1121441847 14:93954483-93954505 CCTGTGAGAGGAAGGAGTGGGTC 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1121441855 14:93954517-93954539 TCAGGCCAAGGCCAGGCCAGGGG 0: 1
1: 0
2: 5
3: 40
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121441847 Original CRISPR GACCCACTCCTTCCTCTCAC AGG (reversed) Exonic
900241518 1:1619671-1619693 CACCCACTCCCACCTCTCCCCGG - Intronic
901548246 1:9975652-9975674 GACTCATTCCTGCCTATCACCGG + Exonic
901849221 1:12004836-12004858 GACCCAGTCCTTCCTCTATGTGG - Exonic
902293034 1:15447401-15447423 TCCCAACTCCTTCCTCTCTCTGG - Intronic
902591415 1:17477654-17477676 GACCCATTCGTTCCTCTCCCGGG + Intergenic
903890620 1:26567953-26567975 GCCCGACTCCTTCCTGTGACTGG + Intronic
904329202 1:29746808-29746830 GAACCACCCCTCCCACTCACAGG - Intergenic
904551241 1:31320796-31320818 GACCCAGTATTTCCACTCACAGG - Intronic
909403126 1:75257051-75257073 CACCCACACTTTCCTTTCACTGG - Intronic
911233262 1:95382653-95382675 GGCCCACTCATACATCTCACAGG - Intergenic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916057930 1:161080829-161080851 GATCCACTCCCTGCTCTCATGGG + Intronic
916694248 1:167220774-167220796 CTCCCGCTCCTTCCTCTCCCCGG - Intergenic
916775237 1:167955289-167955311 GACCCATTCATTCCACTCAAAGG - Intronic
920215661 1:204360092-204360114 GAGCCACCCCATCCTCTCCCGGG - Intronic
922813908 1:228435567-228435589 GACCCCCTCCTGCCCCTCAATGG + Intergenic
922912543 1:229229807-229229829 TACCAACTCCTCCCTCTAACTGG - Intergenic
923023982 1:230189805-230189827 GTCCCATTCCTCCCTCTCCCAGG + Intronic
1062922331 10:1289629-1289651 CACCTCCTGCTTCCTCTCACTGG + Intronic
1063189257 10:3678563-3678585 CTCTCACTCCTTCCCCTCACAGG + Intergenic
1064602581 10:17008567-17008589 TCCCCACTCCCTCCTATCACAGG + Intronic
1067706120 10:48607554-48607576 TCCCCACTCCATCCTCCCACAGG - Intronic
1069942585 10:71965289-71965311 GAATCACTCCCTCCTCTCTCCGG - Intronic
1070913521 10:80137960-80137982 GACCTGCTCCTGCCTCTCAAGGG + Intronic
1071940432 10:90585930-90585952 TCCCCACTCCCACCTCTCACAGG + Intergenic
1072675110 10:97459883-97459905 GTCCCACTTCTTCCTTTCATGGG - Intronic
1073792161 10:106951575-106951597 CACACACACCTTCCCCTCACTGG + Intronic
1074481024 10:113820771-113820793 GACCTGATCCATCCTCTCACAGG - Intergenic
1074546243 10:114404202-114404224 GACCCCCTCCTTCCGCGCCCGGG + Intronic
1076050463 10:127329336-127329358 GGCCTCCTCCTTCCTCTCCCAGG - Intronic
1076609433 10:131712060-131712082 GACCCAGTCCTTGCTCTCCTGGG - Intergenic
1076762399 10:132611982-132612004 CTCCCACACCTTCCTCTGACAGG - Intronic
1077001766 11:326932-326954 GACCCCCTCCTTCCGCTTTCCGG + Intronic
1078428924 11:11272339-11272361 CACCAACTTCTTTCTCTCACTGG + Intronic
1079603796 11:22341868-22341890 CACCCAAACCTTCCTCTCAGTGG - Intronic
1080798370 11:35586917-35586939 GATCCACTCCTTTATCTCAGTGG - Intergenic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1084116172 11:67044364-67044386 GCCCCACTCCTCCCTTCCACCGG - Intronic
1084433276 11:69123229-69123251 CGCCCACTCCCGCCTCTCACAGG - Intergenic
1085683112 11:78596577-78596599 CACCCACTGCTTCCTCTACCTGG - Intergenic
1087162814 11:94966334-94966356 AACCCTCTCCTTAATCTCACTGG - Exonic
1088987842 11:114925707-114925729 GCCCCCCTCCTTCCTCTCTCAGG - Intergenic
1090986380 11:131770031-131770053 GGCCCTCTTCTCCCTCTCACTGG - Intronic
1092080149 12:5709384-5709406 GGCACACTCCTTCCTCTCAAAGG - Intronic
1094009571 12:25792965-25792987 GCTCCACTCCTTCCTGTCTCAGG - Intergenic
1095161508 12:38922693-38922715 GACCCTCTCCCTTCTCTCAGAGG + Intergenic
1096541040 12:52307349-52307371 GGCCCACTCCTCCATCACACGGG + Intronic
1096669042 12:53187425-53187447 GGCTAACTCATTCCTCTCACAGG - Intronic
1099014377 12:77326366-77326388 GACCCACTCGTTCCACTGACTGG - Intergenic
1101234550 12:102775491-102775513 GACTCAAGCCTTTCTCTCACTGG - Intergenic
1101400979 12:104386472-104386494 AACACACTCCTTGCTTTCACTGG - Intergenic
1102142994 12:110631897-110631919 AAACAACTCCTTCCACTCACTGG - Intronic
1102210410 12:111122844-111122866 GACCCACCCCGCCCTGTCACAGG + Intronic
1102517542 12:113459916-113459938 GACTCACCCCTTCCTCAAACAGG - Intergenic
1104402047 12:128484356-128484378 GCTACCCTCCTTCCTCTCACTGG - Intronic
1108161588 13:47645743-47645765 CACTGACTCCTTCCTATCACAGG - Intergenic
1109503641 13:63270382-63270404 GAAGCAGTCCTTCCTATCACAGG - Intergenic
1111002033 13:82197084-82197106 GACCCACTCCTTCCTAACTAGGG + Intergenic
1112509529 13:99997489-99997511 TTCGCACTCCTTCCTCCCACCGG + Intergenic
1114053448 14:18943467-18943489 GACCCAATCCATCCTCTTAGTGG - Intergenic
1114109111 14:19458458-19458480 GACCCAATCCATCCTCTTAGTGG + Intergenic
1114690588 14:24576284-24576306 CACCCCTTCCTTCCTCTCTCAGG - Intergenic
1116516405 14:45811897-45811919 TACCCACTCCTTTCTCTCTCTGG + Intergenic
1116733170 14:48651782-48651804 GACCCACGCCTTCCACTCCTAGG + Intergenic
1117371505 14:55082639-55082661 GACCCACTCATTCTACTCCCAGG + Intergenic
1117997549 14:61492089-61492111 GCCACACTCCTTCCTGTTACTGG - Intronic
1118377664 14:65191193-65191215 GACCAGATCTTTCCTCTCACAGG + Intergenic
1118497624 14:66324520-66324542 GACCAATTCCTTCATCTCTCTGG - Intergenic
1118992658 14:70809792-70809814 GACCCACTCTTCCCGCCCACTGG + Intergenic
1120068800 14:80078978-80079000 GACCCAATCCTTGCTCTCAATGG + Intergenic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1121720242 14:96104177-96104199 GACCCCCTGCTCCCTCTCATGGG - Intergenic
1122138863 14:99650283-99650305 CACACACTCCCTCCCCTCACAGG - Intronic
1122409707 14:101519640-101519662 GCCGCCCTCCTTCCTCTTACGGG - Intergenic
1126454165 15:48843103-48843125 CTCCCTCTCCTTCCTCTTACAGG - Intronic
1127290199 15:57563033-57563055 GAACCACGCCTTTCTCTCTCGGG + Intergenic
1127753230 15:62066807-62066829 GACCCAGTTCTTTCTCTCTCCGG - Intergenic
1128234166 15:66056188-66056210 TACCCAATCCTTCCAATCACTGG + Intronic
1128258167 15:66213300-66213322 GACACACTGCTTCCCCTCTCTGG - Intronic
1129229504 15:74188991-74189013 GACACATTCCTTCCTCTCTCTGG - Intronic
1129892741 15:79082353-79082375 GTCACACTCCTTCCCCTCAGTGG + Intronic
1132989376 16:2785190-2785212 GCTCCACGCCTTCCTCTCAGAGG - Intronic
1133853201 16:9525298-9525320 GGCTCACTCCTTCCTCCCTCAGG + Intergenic
1134080017 16:11318715-11318737 GACCCAAGCCCTCATCTCACAGG + Intronic
1138346047 16:56320853-56320875 GACCCACTCCTTCATGCCTCAGG + Intronic
1139314316 16:66055627-66055649 GACCCTCCCCTGCCTCTCCCCGG + Intergenic
1139325268 16:66147837-66147859 GACACACTCCCTGCTCTCATGGG + Intergenic
1139683408 16:68582834-68582856 GACTCACTCCTTCCTTACCCGGG - Intergenic
1141733554 16:85838024-85838046 GGCCCCCTCCTCCCTCTCCCTGG - Intergenic
1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG + Intronic
1142267786 16:89072482-89072504 GGCCCACTCCTCCCTCTCCCTGG - Intergenic
1143088262 17:4433226-4433248 GACACCCTCCTGCCTCTCACAGG + Intergenic
1144784158 17:17822701-17822723 GACCAACAGCCTCCTCTCACTGG + Intronic
1146465502 17:33083227-33083249 GACACAATCCTTGCTCTCAGAGG + Intronic
1148127366 17:45243769-45243791 TCCCCTCTCCTCCCTCTCACAGG + Exonic
1148227258 17:45907456-45907478 GACACAGTCCTTGCCCTCACAGG - Intronic
1148735073 17:49860676-49860698 CACCCTCTGCTTCCTCTCAGGGG - Intergenic
1149218011 17:54380945-54380967 GGCCCTCTGCTTCATCTCACGGG + Intergenic
1149548075 17:57519073-57519095 CACCCAGTCCTACCTCTCACCGG + Intronic
1151322128 17:73358649-73358671 GACCAACCCCCTCCTCTCATGGG - Intronic
1152338863 17:79713488-79713510 GACCCCCGCCTCTCTCTCACAGG - Intergenic
1152466473 17:80469566-80469588 AACCCACTCCTCCATCTCATGGG - Exonic
1154974964 18:21448459-21448481 GACCCATTCCTTCCTCTAATAGG - Intronic
1155403523 18:25463504-25463526 CTCCCCCTCCTTCCTCTCTCTGG + Intergenic
1156185155 18:34654035-34654057 GTCCCAAGCCTTCCTCTCATAGG - Intronic
1157556853 18:48618535-48618557 GACCCTCCCCTTCCTCTGATGGG - Intronic
1160166665 18:76518856-76518878 GAGCAGCTCCTTCCTCTCTCGGG + Intergenic
1160533296 18:79577720-79577742 GAGCCCAGCCTTCCTCTCACTGG + Intergenic
1161648994 19:5472661-5472683 CACTGACTCCTTCCTCTCGCTGG - Intergenic
1162101237 19:8340534-8340556 AACCCACTTCATCCTCTCCCTGG + Intronic
1163263037 19:16202844-16202866 GATCCAGTCATTCCTCTCTCTGG - Intronic
1163977588 19:20867001-20867023 CACCCACTCATTCATCTCAGTGG + Intergenic
1163977815 19:20869020-20869042 CACCCACTCCTTTCTCACAGTGG + Intergenic
1163978179 19:20872612-20872634 CACCCACTCATTTCTCACACTGG + Intergenic
1163978625 19:20876890-20876912 CACCCACTCATTCATCACACTGG + Intergenic
1163980075 19:20891049-20891071 CACCCACTCATTCATCACACTGG + Intergenic
1163981216 19:20902247-20902269 CACCCACTCATTCCTCACAGTGG + Intergenic
1164275439 19:23713426-23713448 GACCAAGTCCTTTCTCTCAGTGG - Intergenic
1164633820 19:29778524-29778546 GACACACTCCTGCCTCACCCGGG - Intergenic
1165226465 19:34358629-34358651 GACTCGCTCCTTGCTCTCATGGG - Intergenic
1165646297 19:37441132-37441154 AATCCTCTCCTTCCTCTTACAGG + Intronic
1166311761 19:41967089-41967111 CACCCACTCTGTCTTCTCACGGG - Intronic
1167288875 19:48613938-48613960 GACCCTCTCCTTCCACTGTCTGG + Intronic
1167355169 19:48999211-48999233 TTTCCACTCCTTCCCCTCACAGG - Intronic
925132463 2:1503523-1503545 GCCCCAGTCCTTGCTCTCAGAGG + Intronic
927640471 2:24842384-24842406 GACCCTCTCCTGCCCCTCACAGG - Exonic
928139670 2:28717708-28717730 GCCCCATTCCTTCCTGTCCCTGG - Intergenic
930696411 2:54416275-54416297 GCCCCACTCTCTCCTCACACCGG - Intergenic
932018059 2:68053268-68053290 CACTCAGTCCTTCCTCTCACTGG + Intronic
932239766 2:70147423-70147445 GACCCATTTCTGCCTCTCTCTGG - Intergenic
935069642 2:99682679-99682701 GAAGCACTCCTTTCTATCACAGG + Intronic
935175625 2:100646271-100646293 GAGCTCCTCCTTCCTCCCACAGG + Intergenic
937209262 2:120257787-120257809 ATCCCCCTCCTTCCTCCCACAGG + Intronic
938100246 2:128493391-128493413 GACCCGCTCCTTCCTCTGCAGGG - Intergenic
938266051 2:129929076-129929098 GACCTGCTCCTGCCTCTCAAGGG - Intergenic
938480206 2:131657030-131657052 GCCCCACCCCTGCCTCTCCCTGG - Intergenic
939982442 2:148797616-148797638 GACAAGCTCCTTCCTCTCTCTGG - Intergenic
942776804 2:179591444-179591466 GGCCAACCCCTTCCTCCCACTGG - Intronic
947327363 2:228992849-228992871 GACCCACTCCCTGCCTTCACAGG - Intronic
947488716 2:230575684-230575706 GAGCCACTTCTCCCTCTCCCAGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948701462 2:239763215-239763237 GAGGCACTCCTTCCACTCACGGG - Intronic
1172612803 20:36264359-36264381 CACCCCATCCTTCCACTCACCGG + Intronic
1173477019 20:43367029-43367051 GCCCCACTCCTTCCTCCCTCTGG - Intergenic
1175060440 20:56237222-56237244 GACCCACTTCCTCCTGTCAATGG + Intergenic
1175116414 20:56685779-56685801 GTCCCTCTCCTTCCTGTCTCTGG + Intergenic
1175206809 20:57317481-57317503 GACCCCCACCTTTCTCTCAATGG - Intergenic
1175245732 20:57580908-57580930 GACCCAGCCCTTGCACTCACAGG - Intergenic
1175769004 20:61611202-61611224 GCCCCTTTCCTTCCTCTCCCTGG + Intronic
1176057060 20:63154563-63154585 CACCCCCACCTGCCTCTCACTGG - Intergenic
1179312220 21:40206518-40206540 GAGGCACCCATTCCTCTCACTGG - Intronic
1179418400 21:41216567-41216589 GACCCGGTCCTGCCTCTCAGGGG - Intronic
1179722368 21:43322961-43322983 GACACACTCCTGTCCCTCACTGG - Intergenic
1180471917 22:15665848-15665870 GACCCAATCCATCCTCTTAGTGG - Intergenic
1183379327 22:37483099-37483121 GACCTGCTCCTCCCTCTCACTGG + Intronic
1184115529 22:42419706-42419728 TACCCATTCCTTCCTCTCCTGGG + Intronic
1184639235 22:45860319-45860341 GGCCCAGTCCCTACTCTCACCGG + Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
949129984 3:488023-488045 GACCAAGTCCCTCCTCTCATGGG - Intergenic
949385790 3:3501138-3501160 GACCAACGCCTTCCTCTCGTTGG + Intergenic
949933293 3:9097540-9097562 GACCCAGACTTTCCTCCCACTGG + Intronic
950321262 3:12056273-12056295 GACCCCCTCCTTCCCCGCAAAGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950852049 3:16071222-16071244 GGCCCACTCCATCTTCTCAAAGG + Intergenic
952269956 3:31820798-31820820 GAGAAACTCCTTCCTCTCAAAGG + Intronic
953931283 3:47007116-47007138 GCCCCACTCCTTCATCACCCAGG + Exonic
954687817 3:52380122-52380144 GCCCCTCACCTTACTCTCACTGG - Exonic
957293738 3:78310299-78310321 GACCAACTTCTTCCTGTCTCTGG + Intergenic
957959461 3:87230623-87230645 AACCCACTCCTGACTCTCCCTGG + Intronic
958507379 3:94997573-94997595 GACCCACTGCTTCCTAAAACAGG - Intergenic
960753535 3:120982922-120982944 AGCCCACTCCTCCCTATCACAGG - Intronic
961654399 3:128433285-128433307 GACCCGCTCCTCCCTCCCCCCGG + Intergenic
961706367 3:128789260-128789282 CACCGACCACTTCCTCTCACAGG - Intronic
962736518 3:138329953-138329975 GACTCCCTCCTGCCTCTCCCTGG - Intergenic
962929915 3:140026783-140026805 GACCCCCTACTTCCTATCTCAGG + Intronic
966727487 3:183120525-183120547 GAGCCACTCCTTCCTGACCCGGG - Intergenic
968833775 4:2948017-2948039 GACCTTCACCTTCATCTCACAGG - Intronic
971297091 4:25405083-25405105 GACTCTCTCCGTCCTTTCACAGG - Intronic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
973531843 4:51843388-51843410 GAACCACCCCTTCCCCTCCCGGG + Intronic
973571157 4:52241208-52241230 GACCAACTCCTTCCTCCCTAGGG - Intergenic
973967739 4:56181278-56181300 CACCCACTGCTTCCTCTACCTGG - Intronic
974613807 4:64253948-64253970 GATCCACTCTTTACTGTCACAGG + Intergenic
977234575 4:94492886-94492908 GACCCACTAATTCCTCTCCTAGG - Intronic
979051507 4:115940078-115940100 CACCCAATCCTTCCTCCCTCAGG + Intergenic
980775430 4:137430761-137430783 GAGGCAATCCTTCCTATCACAGG + Intergenic
981141576 4:141275701-141275723 GACCCATTCCTTCCTGCCTCTGG + Intergenic
982344827 4:154345689-154345711 GACACAGTCCTTGCTCTCATGGG - Intronic
983299623 4:165908720-165908742 GACCTACCCCTTCCCATCACAGG - Intronic
984742283 4:183176773-183176795 CATCCTCTCCTTACTCTCACAGG + Intronic
984762807 4:183377115-183377137 CACCCCCTCCCTCCTCTCCCAGG + Intergenic
985624608 5:978637-978659 GACCCACGCCTTCAGCTTACAGG - Intergenic
985628178 5:1000929-1000951 GACCCACTCCTTCCCCTGCCCGG - Intergenic
985852206 5:2397174-2397196 GTCCCACTGCCTCCTCTCCCAGG + Intergenic
986321587 5:6636351-6636373 TACCCACAGCCTCCTCTCACCGG - Intronic
986338713 5:6773068-6773090 CACCCACTACATCCTCTCTCAGG - Intergenic
986569866 5:9153653-9153675 CAACCACTCCTTCTTCTCAAGGG + Intronic
986784780 5:11104292-11104314 ATCCCACTCTTTCCTCTCAGGGG + Intronic
990471173 5:56117023-56117045 GACCCACTACTTCCTCTTCTAGG - Intronic
993484712 5:88468773-88468795 GACCCTGTCCTTCCTCTTCCTGG + Intergenic
997380831 5:133436377-133436399 AACACACTCCTTCCTGCCACAGG - Intronic
997566685 5:134893383-134893405 TACCCACCCGTTCCTCTCCCTGG + Intronic
997593799 5:135092700-135092722 CACCCTCTCCTTCCTCACCCCGG + Intronic
998363524 5:141612282-141612304 GACCCAGTCATTCCACTCATGGG + Intronic
999929602 5:156416673-156416695 GACAAACTCCTTCATCTCTCTGG + Intronic
1000164838 5:158638492-158638514 CACTCACTCCTTCCTCTCCTTGG - Intergenic
1001267252 5:170282804-170282826 GACCCAATCCTTCCATTCACAGG - Intronic
1001449888 5:171816528-171816550 GAACAACTCATTCCTCACACTGG + Intergenic
1001902711 5:175444710-175444732 GACTCACTCCTTCCCCGCCCAGG + Intergenic
1002290327 5:178196036-178196058 GAGCCACTGCTGCCTCTCAGAGG + Intergenic
1002718162 5:181241637-181241659 GACAAACTCCTCCCTCTCAGGGG - Exonic
1003241951 6:4352767-4352789 GTCCCACTCCTCTCTCTCAAGGG - Intergenic
1003244102 6:4369756-4369778 AACTCACTGCTTCCTCTTACAGG - Intergenic
1004429542 6:15531312-15531334 AACCCTCTCCTTCCTCCCAAAGG + Intronic
1004655531 6:17656313-17656335 CACCCAGTCCTTCCCATCACTGG - Intronic
1006819146 6:36876949-36876971 TACCCATTCCTTCCTCCCAAAGG + Intronic
1006844288 6:37051731-37051753 GCCCACCTCCTTCCTCCCACAGG + Intergenic
1010341064 6:74753417-74753439 GAGCCTCTCTTTCCTCTGACTGG + Intergenic
1010768820 6:79805607-79805629 GACACATTCCTTCATTTCACAGG - Intergenic
1011383371 6:86766904-86766926 GACATACTACTTCCTTTCACTGG - Intergenic
1013559688 6:111291876-111291898 GCCCCTCTGCTACCTCTCACTGG + Intergenic
1014088235 6:117372668-117372690 GAGTCGCTCATTCCTCTCACTGG + Intronic
1018971567 6:168533044-168533066 GACCTACTGCTGCCTGTCACAGG - Intronic
1019137846 6:169922339-169922361 GACCCACTCGTGCCTCTGCCAGG - Intergenic
1019415772 7:925932-925954 GACCCCCTCGTACCTGTCACAGG - Intronic
1020769312 7:12368456-12368478 CACTCACTGCTCCCTCTCACCGG - Intronic
1021120954 7:16795115-16795137 GACACACTCCATTCCCTCACAGG - Intronic
1022357705 7:29631357-29631379 CACCCACTCCTCCCTCTCATAGG + Intergenic
1022368024 7:29744312-29744334 CACCCACTCCTCCCTCTCATAGG + Intergenic
1024997099 7:55280202-55280224 GACCCACTTCTTCCCATCTCAGG - Intergenic
1025129689 7:56368910-56368932 GGCTCACACCTTCCTCTCTCAGG + Intergenic
1025176174 7:56803544-56803566 GCCCCACTCCTGCCTCCCAGGGG - Intergenic
1025695619 7:63772878-63772900 GCCCCACTCCTGCCTCCCAGGGG + Intergenic
1029796545 7:102900708-102900730 AACCCATTTCTTACTCTCACTGG + Intronic
1032078326 7:128846550-128846572 GCCCCACCCCATCCTCTCTCAGG + Intronic
1032474015 7:132200120-132200142 GGCCCACTCCTTCGTTTCCCAGG + Intronic
1032845529 7:135748661-135748683 GAAGCACTCCATCATCTCACTGG - Exonic
1032900890 7:136305998-136306020 GGCCCACTCAAACCTCTCACAGG - Intergenic
1034671478 7:152862178-152862200 CACCCTGTACTTCCTCTCACGGG - Intergenic
1035074878 7:156170597-156170619 GAACCCCGCCTTCCTCTCAGAGG + Intergenic
1035842332 8:2826298-2826320 GACCCACGCCTTCCTCCCTAAGG - Intergenic
1038014821 8:23505429-23505451 GACCCACAATTTCCTCTCACAGG + Intergenic
1039764982 8:40619036-40619058 GACCCACTCCCTCACCTCTCAGG - Intronic
1041169157 8:55123436-55123458 AATCCACTCCTTCCACCCACTGG - Intronic
1041383289 8:57274651-57274673 CACCAACTCCATCCTCTCAGAGG + Intergenic
1044729615 8:95219466-95219488 GGCCCTCTCCTCCTTCTCACTGG + Intergenic
1044794924 8:95886893-95886915 TGCCCACTCCTTCCTCTCCTGGG + Intergenic
1046673163 8:117079721-117079743 GACCCACTCCATCCTCAGGCAGG - Intronic
1049910195 9:258476-258498 CACCCACTCCCTCCTCTACCTGG - Intronic
1049915327 9:311932-311954 GACCCACTGTTTTCTCTCACAGG + Exonic
1050718447 9:8557072-8557094 TGGGCACTCCTTCCTCTCACTGG - Intronic
1051001412 9:12287017-12287039 GGCCCTCCCCCTCCTCTCACAGG - Intergenic
1052827393 9:33187014-33187036 CACCTAGTCCTTCCTCTCTCTGG + Intergenic
1052965189 9:34335177-34335199 AACCCACAACTTCCTTTCACTGG - Intronic
1054938024 9:70710094-70710116 CACCCACTCCTCCGTCTCCCTGG + Intronic
1054939715 9:70728087-70728109 CACCCACTCCTCCGTCTCCCTGG + Intronic
1055508236 9:76969849-76969871 GACACACTCCTTCTTCTCTCAGG - Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1057863699 9:98662726-98662748 GACCCACTCCTCCCTAACACAGG + Intronic
1060551981 9:124489986-124490008 TCCCCACTCCTCCCTCTCTCTGG + Intronic
1061195800 9:129106504-129106526 GCACCCCTCCTTCCACTCACGGG - Intronic
1061429095 9:130519879-130519901 GACCCAGTCCTTCCGAGCACAGG + Intergenic
1187717848 X:22121263-22121285 GACCCCCTCATTCTCCTCACTGG - Intronic
1188032927 X:25284636-25284658 GACCCACTCAGTCCTAACACAGG + Intergenic
1188111287 X:26198277-26198299 CAGCCACTCATTCCTCTCCCTGG + Intergenic
1190233264 X:48598270-48598292 GAGCCCCACCTCCCTCTCACAGG - Intronic
1190306323 X:49084565-49084587 GACCAACTTTGTCCTCTCACAGG + Intronic
1192236687 X:69300622-69300644 GACCCCCACCTTCAACTCACTGG - Intergenic
1193052970 X:77121071-77121093 GTCCCAGTTCTTCCACTCACTGG + Intergenic
1196306935 X:114114160-114114182 GCCTCACTCCTTCATATCACTGG - Intergenic
1196791364 X:119468220-119468242 GACCCGCCCCTTCCTCTCGCCGG + Intergenic
1196911443 X:120488316-120488338 CTCCCACCCCTTCCTTTCACAGG - Intergenic
1199700444 X:150371540-150371562 GACCCACACTTTCCTCTCACAGG - Intronic
1200940630 Y:8776413-8776435 GAGCCACACCTTCCTCTACCGGG + Intergenic
1201975594 Y:19845327-19845349 GAACCACTCCTATTTCTCACTGG + Intergenic