ID: 1121445004

View in Genome Browser
Species Human (GRCh38)
Location 14:93973156-93973178
Sequence CCCTGGTTGTCACCTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121445004_1121445007 -1 Left 1121445004 14:93973156-93973178 CCTGTAGGAGGTGACAACCAGGG 0: 1
1: 0
2: 0
3: 14
4: 215
Right 1121445007 14:93973178-93973200 GATTTGAACCTGTCCAAAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121445004 Original CRISPR CCCTGGTTGTCACCTCCTAC AGG (reversed) Intronic
900375121 1:2350698-2350720 CCCTGGAGGGCACCTCCTGCTGG - Intronic
901395682 1:8979709-8979731 ACCTGGTTGTCCCCTGCTCCAGG + Intergenic
902402603 1:16166346-16166368 GCCAGGTAGTCACCTCCTAGCGG + Intergenic
903968129 1:27102308-27102330 CCCAGGTGGCCACCTCCAACCGG + Intronic
904340406 1:29830428-29830450 CCCAGCTTGTCACCTCACACTGG - Intergenic
905345741 1:37309864-37309886 CCGTAGATGTCACCTCCTTCAGG + Intergenic
905896957 1:41554318-41554340 CCATGGTTTTCAGCTCCAACAGG + Intronic
906581429 1:46938128-46938150 CCCTTGTTGACAGCTCCAACAGG - Exonic
906690152 1:47787210-47787232 AACTGGTTTTCACCTCCTCCAGG + Intronic
907335259 1:53695424-53695446 CCCTGTCTGTCACCTTCTTCTGG - Intronic
910982728 1:92974956-92974978 ACCTGGTGGTCCCCTACTACTGG + Intergenic
913285128 1:117218908-117218930 CCGTGGTTTTCAGCTCCTTCAGG - Intergenic
917267152 1:173233138-173233160 CCATGGTTTTCACCTCCATCAGG - Intergenic
919914066 1:202129344-202129366 TCCTGGATGCCTCCTCCTACTGG + Exonic
921397148 1:214680596-214680618 CCTTGGTTATCACTTCCTCCTGG + Intergenic
922210762 1:223484764-223484786 CTCTGGTACTCACCTCCTTCAGG + Intergenic
923237497 1:232048352-232048374 TCCTGGGTGTAACCTCCTCCAGG + Intergenic
924045518 1:240025311-240025333 CCCTGGGTGTCACATCCCCCAGG - Intronic
1063135903 10:3215853-3215875 CCCTGGCAGCCACCTCCTGCAGG - Intergenic
1064792198 10:18970564-18970586 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
1068821121 10:61378209-61378231 CCATGGTTTTCACATCCAACAGG + Intergenic
1070676087 10:78412501-78412523 ACCTGGTTCACACCACCTACTGG - Intergenic
1070757319 10:79001407-79001429 GCCTAGTTGTCACTTCCTCCAGG + Intergenic
1070811947 10:79302553-79302575 CCCAGGTCATCACCTCCTCCAGG - Intronic
1074085084 10:110203815-110203837 CACTGGGTGTCACCTGCTCCTGG - Intergenic
1075680144 10:124325686-124325708 GCCTGGCTGTCACTTCCTCCAGG + Intergenic
1076572562 10:131442106-131442128 TCCTGGTTCTCACCTCCAAGGGG - Intergenic
1077167909 11:1152067-1152089 CCCTGCAGGTCACCTCCTAGGGG + Intergenic
1077697239 11:4405626-4405648 CCTTGGTTTTCAGCTCCTTCAGG + Intergenic
1078924890 11:15865597-15865619 CCATGGGTGCCACCTCTTACGGG + Intergenic
1082174374 11:49045030-49045052 CCATGGTTTTCACCTCCATCAGG + Intergenic
1082890055 11:58129538-58129560 CTCTGGTTTTGATCTCCTACTGG + Intronic
1083276385 11:61599345-61599367 CCCTTATTGTCACCTCCTCCTGG - Intergenic
1086691401 11:89791055-89791077 CCATGGTTTTCACCTCCATCAGG - Intergenic
1086714401 11:90048598-90048620 CCATGGTTTTCACCTCCATCAGG + Intergenic
1088368747 11:109066189-109066211 CACTGGTTCCCACCTCCTAGTGG - Intergenic
1090071386 11:123547346-123547368 TGCTGGATGTCACCTGCTACTGG + Intronic
1090557451 11:127891854-127891876 ACCTGGTTCTCATCACCTACTGG - Intergenic
1090613490 11:128493213-128493235 CCTTGGCTGTCACCTCACACTGG - Intronic
1090658653 11:128864939-128864961 CCCCGGTTCTCACCACCTTCCGG + Intronic
1092125394 12:6071833-6071855 CCCTGGATGTCACCTCTGGCTGG - Intronic
1094710549 12:32957478-32957500 CCCTGGTTTTCAGCTCCATCAGG - Intergenic
1097775114 12:63635596-63635618 CCTTGGTTTTCACCTCCATCAGG - Intronic
1098885633 12:75957965-75957987 ACCTGGTTGTCTCCTGCTTCTGG + Intergenic
1101401636 12:104393392-104393414 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1101904826 12:108816712-108816734 GCGTTGTTGTCACCTCCTTCAGG + Intronic
1102546837 12:113663456-113663478 CTCTGGCTGGCACCTCCTCCTGG + Intergenic
1103154552 12:118673408-118673430 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1103371881 12:120425387-120425409 ACCTGGCTGTCAACTCCTTCGGG - Intergenic
1103873422 12:124107578-124107600 CCCTGTTGGCCACCTCCTTCTGG + Intronic
1104741479 12:131177961-131177983 CACTTGTGGACACCTCCTACTGG + Intergenic
1106136894 13:26980180-26980202 CCCTGCTGGTCACCTCTTCCCGG - Intergenic
1110949291 13:81464409-81464431 CCTTGGTTTTCAGCTCCTTCAGG + Intergenic
1111854055 13:93613820-93613842 CCCTGGATGTCACTTCGTAGAGG + Intronic
1112178593 13:97053962-97053984 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1115294547 14:31811450-31811472 CCATGGTTTTCAGCTCCTTCAGG + Intronic
1115300568 14:31880684-31880706 CACTCGTTGTCACCTGCTGCAGG + Intergenic
1115624755 14:35179570-35179592 CCATGGTTGTCAGCTCCATCAGG + Intronic
1117511497 14:56455752-56455774 CCCTGGTTTTCAGCTCCATCAGG - Intergenic
1117576600 14:57105313-57105335 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1119767763 14:77201138-77201160 CCTTGGCTGGCACCTCCTCCAGG + Intronic
1121445004 14:93973156-93973178 CCCTGGTTGTCACCTCCTACAGG - Intronic
1121759565 14:96433502-96433524 CCATGGTTTTCAGCTCCTTCAGG + Intronic
1122635558 14:103128072-103128094 CGCTGGCTTTCACCTCCTCCAGG - Intronic
1122762827 14:104042579-104042601 CCCTGTTTCTCACCTCCTGCTGG + Intronic
1123982155 15:25614043-25614065 TGCTGGATGACACCTCCTACTGG + Intergenic
1124130812 15:26984001-26984023 GCCTCGTTGTCGCCCCCTACAGG + Intronic
1124260403 15:28184373-28184395 CCCAGGCAGTCTCCTCCTACAGG - Intronic
1124561378 15:30776554-30776576 CCATGGTTTTCACCTCCATCAGG - Intergenic
1125507174 15:40273612-40273634 CCCTGGTGGGAACCCCCTACTGG + Exonic
1130333834 15:82942100-82942122 GCTTGGATGTCACCTCCTTCAGG + Intronic
1132455552 16:19998-20020 CCATGGTTTTCACCTCCATCAGG + Intergenic
1132991553 16:2798313-2798335 CCCTGGCTTTCAGCTCCTAAGGG - Intergenic
1134021019 16:10921814-10921836 CCGTGGGAGTCACCACCTACTGG - Intronic
1134255262 16:12605061-12605083 CCTTGGTTTTCATCTCCTACAGG - Intergenic
1136501182 16:30670288-30670310 CCCTGTTGGTCATCTCCTGCTGG - Exonic
1136544247 16:30947047-30947069 CCCAGGTTGCCACCGCCTAACGG + Exonic
1137699693 16:50488694-50488716 CCATGTTTGCCACCTCATACAGG - Intergenic
1139105377 16:63820977-63820999 CCATGGTTTTCACCTCCATCAGG - Intergenic
1142005735 16:87688881-87688903 TCTTGGTTCTCACCTCCTGCTGG + Intronic
1143502926 17:7349353-7349375 CCCAGGCTCTCACCTCTTACAGG + Intronic
1145169105 17:20639671-20639693 CTGAGGTTGTCACCTCCTCCAGG - Intergenic
1145813651 17:27780641-27780663 CCCTGAGTGTCACCTGCTGCTGG + Intronic
1146590400 17:34123494-34123516 CCCTGGGAGTCACCTTGTACAGG + Intronic
1152136619 17:78507616-78507638 GCCAGCTTGTCACCTCCTTCAGG + Exonic
1158145595 18:54308913-54308935 CCATGGTTTTCAGCTCCTTCAGG + Intronic
1158647256 18:59257939-59257961 CCGTGGTTTTCACCTCCATCAGG - Intergenic
1160151653 18:76399803-76399825 CCCAGGTGGTCACCACCTGCAGG + Intronic
1161994100 19:7701900-7701922 CTCTGGTTGTGACCTCCTGCTGG + Intronic
1162600312 19:11663842-11663864 CCCAGGCTCTCACCTCCTACAGG - Intergenic
1165156594 19:33792462-33792484 CCCTCCTTGTCACGTCCTATTGG - Intergenic
925825732 2:7846815-7846837 CTCTGGTAGTCACCTTCTGCAGG - Intergenic
926276060 2:11404036-11404058 GCCTGGTGGCCCCCTCCTACCGG + Intergenic
928487788 2:31749817-31749839 CCATGGTTTTCACCTCCATCAGG - Intergenic
929958225 2:46476873-46476895 CCATGGTTTTCAGCTCCTTCAGG + Intronic
930150791 2:48057728-48057750 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
930274938 2:49299782-49299804 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
931043748 2:58326632-58326654 CCATGGTTTTCAGCTCCAACAGG - Intergenic
936762530 2:115804263-115804285 CCTTGGTTTTCAGCTCCAACAGG + Intronic
937302975 2:120854491-120854513 CCCTGATTGTCACAGCCTGCAGG - Intronic
939074767 2:137587168-137587190 CCATGGTTTTCACCTCCATCAGG + Intronic
939193266 2:138941783-138941805 CCATGGTTGTCATCTCCATCAGG + Intergenic
941620921 2:167777900-167777922 TTCTGGTTGTCACATCCAACAGG + Intergenic
943716903 2:191161880-191161902 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
946391219 2:219418098-219418120 CCCTGGTTATCTCCTCGTCCTGG - Intergenic
946933851 2:224699249-224699271 CCCTAGTTTTCATCTCCCACAGG + Intergenic
948393643 2:237629091-237629113 GTCTGGGTGTCACCTTCTACAGG - Intronic
948599554 2:239100590-239100612 CCTTGGTTGTCCGCTCCTAAGGG + Intronic
948921241 2:241066886-241066908 CCTTGGTGGTCAACTCCTGCAGG - Intronic
1168952767 20:1813831-1813853 CCCTTGATGTCTCCTCCGACTGG - Intergenic
1170494495 20:16912264-16912286 CCATGGTTTTCACCTCCATCAGG + Intergenic
1171194665 20:23187620-23187642 ACCTGGTTATCTCCTCCTTCCGG - Intergenic
1172532704 20:35644172-35644194 CCCTGTTTGTGAGCACCTACAGG - Intronic
1175269746 20:57725450-57725472 GCCTGAATGTCACCTCCTCCTGG + Intergenic
1178924200 21:36761568-36761590 CCCTGGTTGTCACAGCCTGAGGG + Intronic
1180094612 21:45550158-45550180 CCCAGGCTGGCACCTCCTCCTGG + Intergenic
1181673419 22:24436758-24436780 CACTGGGTGACACCTCCTCCAGG - Intronic
1182512128 22:30827003-30827025 AGCTGGGTGTCACCTCCTCCAGG - Intronic
951803148 3:26619157-26619179 CCCTGGTTCTCAACTCCTGTCGG + Intergenic
953281608 3:41563690-41563712 CCATGGTTTTCACCTCCTTCAGG + Intronic
957565537 3:81879420-81879442 CCTTGGTTTTCAGCTCCTTCAGG - Intergenic
958253055 3:91292427-91292449 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
959953839 3:112212515-112212537 CCATGGTTTTCACCTCCATCAGG - Intronic
960276674 3:115737299-115737321 CCATGGTTTTCACCTCCATCAGG + Intergenic
960412798 3:117348513-117348535 CACTGGTAGGCACCTCCAACTGG + Intergenic
960516147 3:118604649-118604671 TGCAGGTTATCACCTCCTACAGG + Intergenic
960731935 3:120737355-120737377 CCATGGTTTTCAGCTCCAACAGG + Intronic
963712766 3:148766545-148766567 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
964214479 3:154263884-154263906 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
967195454 3:187021886-187021908 CCCTGGTTGTGCCGCCCTACAGG - Intronic
967630411 3:191738311-191738333 CCCTGGGTGTGCCCGCCTACTGG - Intergenic
968720254 4:2197279-2197301 CACAAGTTGTTACCTCCTACTGG - Intronic
969422357 4:7104758-7104780 ACCTGGTTGTCACCTCCCCCAGG + Intergenic
970182957 4:13418062-13418084 CCCTGGTTTTCAGCTCCATCAGG - Intronic
973640665 4:52899982-52900004 CCGTGGTTGTCAGCTCCATCAGG + Intronic
974347185 4:60697130-60697152 CCATGGTTTTCAGCTCCAACAGG - Intergenic
974841010 4:67299812-67299834 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
976263206 4:83165357-83165379 CCATGGTTTTCACCTCCATCTGG - Intergenic
976574650 4:86656074-86656096 CCATGGTTTTCAGCTCCTTCAGG + Intronic
980195989 4:129589856-129589878 CCATGGTTTTCAGCTCCTCCAGG + Intergenic
981243099 4:142502259-142502281 TCCTGGGTGTGACCTCCTCCAGG - Intronic
983657821 4:170100796-170100818 CAGTGATTGTCCCCTCCTACAGG + Intergenic
983885851 4:172979708-172979730 CACTGGTTGACACCTACCACTGG + Intronic
989820261 5:45787436-45787458 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
990860261 5:60319317-60319339 CCTTGGTTTTCACCTCCATCAGG + Intronic
992630667 5:78677004-78677026 CCCTGGTTGTCACTTCCAGAAGG - Intronic
993244408 5:85432755-85432777 CCCTGGTTTTCAGCTCCATCAGG - Intergenic
995116936 5:108491731-108491753 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
995529059 5:113074697-113074719 CCGTGGTTTTCAGCTCCTTCAGG - Intronic
1000036741 5:157454505-157454527 AGATGGTTGTCACCTCCTTCAGG - Intronic
1002561084 5:180082784-180082806 CATTGGCTGTCACCTTCTACAGG - Intergenic
1003053317 6:2798727-2798749 CCCTGGCTGTCTCCTCCTCTCGG - Intergenic
1004908738 6:20261196-20261218 TCCAGGTTGTCCACTCCTACTGG + Intergenic
1005681022 6:28208148-28208170 CCCTGGGTGGCACCTTCTAAGGG + Intergenic
1007223259 6:40295301-40295323 CCTTGGCTGTCACCTCCTATTGG + Intergenic
1010671868 6:78695616-78695638 CCCTGGTTTTCAGCTCCAACAGG - Intergenic
1010997538 6:82550811-82550833 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1013414550 6:109913188-109913210 CCCTGAGTGTCACCTTCCACTGG - Intergenic
1013833842 6:114308733-114308755 GTCTGGTTTTCACCTCCTCCTGG - Intronic
1017226666 6:152029450-152029472 CCTTGGTTGTCAGCTCCATCAGG - Intronic
1017279758 6:152610305-152610327 CCATGGTTTTCAGCTCCTTCAGG - Intronic
1020774023 7:12431164-12431186 CCATGGTTTTCAGCTCCAACAGG + Intergenic
1021149647 7:17134107-17134129 CCCTGCTTATCACCTCCCACAGG - Intergenic
1021775395 7:24049689-24049711 CCCTGACTATTACCTCCTACAGG + Intergenic
1021947511 7:25742819-25742841 CTCTGGTTCTCACCTCTTACAGG - Intergenic
1022079628 7:27007272-27007294 CCCTGGTTTTCAGCTCCATCAGG + Intergenic
1022901543 7:34815231-34815253 CCATGGTTTTCAGCTCCTTCAGG - Intronic
1022972324 7:35529625-35529647 CCAGGGTTGGCACATCCTACAGG - Intergenic
1023691855 7:42797437-42797459 CCATGGTTCTCACCTCCATCAGG - Intergenic
1028793089 7:94875692-94875714 CCCTGGGTGTGACCTTCTTCAGG - Intergenic
1029599204 7:101553892-101553914 CCCTGGCTGCCCCCTCCCACTGG - Intronic
1029850050 7:103452684-103452706 CCTTGGTTTTCACCTCCATCAGG + Intergenic
1030154575 7:106440675-106440697 CCATGGTTTTCACCTCCGTCAGG - Intergenic
1030970428 7:116048290-116048312 CCATGGTTTTCAGCTCCTTCAGG - Intronic
1032006916 7:128309739-128309761 CACTAGTTGTCGCCTCCTCCTGG - Exonic
1032958645 7:137003813-137003835 CCATGATTGTTACCTCCCACTGG - Intronic
1034372018 7:150606892-150606914 CCTTGGTTTTCAGCTCCAACAGG - Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1034919512 7:155068455-155068477 CCTGGGTTGTCACCTCTTATGGG - Exonic
1037550932 8:19970695-19970717 CCTCAGTTTTCACCTCCTACTGG + Intergenic
1037731717 8:21531169-21531191 CCCAGGTTGACTCCTACTACTGG - Intergenic
1039150419 8:34498707-34498729 TCCTTTTTCTCACCTCCTACAGG + Intergenic
1039796248 8:40918074-40918096 TCCTGGGTGTGACCTCCTCCAGG + Intergenic
1040062059 8:43112226-43112248 CCGTGGTTTTCAGCTCCTTCAGG - Intronic
1040097295 8:43458768-43458790 CCTTGGTTTTCACCTCCATCAGG + Intergenic
1040539362 8:48338762-48338784 CCTTGGTTTTCAGCTCCTTCAGG + Intergenic
1043089077 8:75875211-75875233 CCATGGTTTTCAGCTCCAACAGG + Intergenic
1043535899 8:81204249-81204271 CCATGGTTTTCAGCTCCAACAGG + Intergenic
1043870177 8:85423677-85423699 CCTTGGTTTTCAGCTCCTTCAGG + Intronic
1044272695 8:90265407-90265429 CCCTGGTTTTCAGCTCCATCAGG - Intergenic
1045253439 8:100499954-100499976 CACTGGTCGTCAGCTCCTAGAGG + Intergenic
1048466528 8:134668911-134668933 CCATGGTTTTCACCTCCATCAGG - Intronic
1048687615 8:136921455-136921477 CCATAGTGGTCACCTCCTAAAGG - Intergenic
1048796504 8:138154603-138154625 CCATGGTTTTCAGCTCCTTCAGG - Intronic
1049257307 8:141620813-141620835 CCCTGGGAGGCAGCTCCTACAGG - Intergenic
1049521694 8:143094749-143094771 CCCTGGTCCTCACCTCCTCCGGG + Intergenic
1049670731 8:143868660-143868682 CCCTGGCTGACACCTGCTTCCGG + Exonic
1050370784 9:4919877-4919899 CCGTGGTTTTCACCTCCATCAGG + Intergenic
1051652219 9:19339520-19339542 CTCAGGTTGTCACGTCCTACAGG + Intronic
1055712639 9:79080971-79080993 CCCTGGTTATGAAATCCTACGGG - Intergenic
1058740610 9:107938855-107938877 CCCTCCTTCTCATCTCCTACTGG - Intergenic
1058750078 9:108031417-108031439 CCATGGTTGTCAGCTCCATCAGG + Intergenic
1058918201 9:109587719-109587741 ACCTGGTTATAACCTCTTACTGG + Intergenic
1058961039 9:109993310-109993332 CCCTGGTGGCCACCTCTTAGTGG - Intronic
1060567616 9:124607303-124607325 ACCTGGTGGTCCCCTGCTACTGG - Intronic
1061063287 9:128261597-128261619 CACTGGTTGTCACCTACTCCTGG + Intronic
1062599544 9:137313679-137313701 CCCAGGTTGGCAACTCCTGCAGG - Intronic
1185781811 X:2854427-2854449 GCCGGGCTGTCACCTCTTACTGG + Intronic
1187848384 X:23565499-23565521 CCATGGTTTTCAGCTCCTTCAGG + Intergenic
1188123222 X:26335300-26335322 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
1190608760 X:52172074-52172096 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
1191138229 X:57089832-57089854 CCATGGTTTTCAGCTCCAACAGG + Intergenic
1191251902 X:58263802-58263824 CCCTGATTGTCCCCTTCTTCCGG - Intergenic
1191799109 X:65057915-65057937 CCATGGTTTTCAGCTCCTTCTGG + Intergenic
1191938813 X:66455133-66455155 CCTTGGTTTTCAGCTCCTTCAGG - Intergenic
1192477847 X:71459087-71459109 CCTTGGTTAACTCCTCCTACAGG + Intronic
1192683841 X:73282657-73282679 CCATGGTTTTCAGCTCCTTCAGG - Intergenic
1193167105 X:78293811-78293833 CCATGGTTTTCAGCTCCTTCAGG + Intronic
1193961541 X:87931238-87931260 CCCTATTTGTCACCTTCTATTGG - Intergenic
1195587112 X:106577977-106577999 CCTTGGTTTTCAGCTCCAACAGG + Intergenic
1196896892 X:120345545-120345567 CCTTGGTTTTCACCTCCATCAGG - Intergenic
1198474378 X:136981955-136981977 CCCTGGTTTTCAGCTCCATCTGG + Intergenic
1198553401 X:137768150-137768172 CCATGGTTTTCACCTCCATCAGG + Intergenic
1199481606 X:148304557-148304579 CCATGGTTTTCAGCTCCAACAGG + Intergenic
1200400821 X:156019731-156019753 CCATGGTTTTCACCTCCATCAGG - Intergenic
1201731987 Y:17214046-17214068 CCTTGGTTTTCAGCTCCTTCAGG - Intergenic
1202170898 Y:22042217-22042239 CCATGGTTTTCACCTCCCTCAGG - Intergenic
1202220465 Y:22544156-22544178 CCATGGTTTTCACCTCCCTCAGG + Intergenic
1202322648 Y:23651507-23651529 CCATGGTTTTCACCTCCCTCAGG - Intergenic
1202548125 Y:26018549-26018571 CCATGGTTTTCACCTCCCTCAGG + Intergenic