ID: 1121445487

View in Genome Browser
Species Human (GRCh38)
Location 14:93975983-93976005
Sequence CCTAGGCATGCACGGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121445487 Original CRISPR CCTAGGCATGCACGGTATTG TGG (reversed) Intronic
909344572 1:74571116-74571138 CCTAGACCTGCACGTTGTTGGGG + Exonic
920612534 1:207455239-207455261 ACTAGGAATGCACGGTACCGTGG - Intronic
922322479 1:224500844-224500866 CTTAGGCATCCACTGCATTGTGG - Intronic
1077611582 11:3646224-3646246 CCTGGGCAGGCAGGATATTGGGG + Intronic
1081666605 11:44920361-44920383 CTTAGCCATGCACTGTATTTTGG + Intronic
1082002091 11:47398787-47398809 CCTGGGCATGCAAGGGGTTGGGG + Intergenic
1094852654 12:34389205-34389227 CCCAGGCATGCACGGTGGGGAGG - Intergenic
1098488592 12:71049704-71049726 CCCAGGCAGGAAGGGTATTGAGG + Intronic
1105658367 13:22465228-22465250 GCAAGGCATGGACTGTATTGTGG + Intergenic
1113315987 13:109179364-109179386 CATGGGCATGCACAGTATTGTGG - Intronic
1116789875 14:49329229-49329251 CCTTGGCATGCATGGGATTTGGG - Intergenic
1121445487 14:93975983-93976005 CCTAGGCATGCACGGTATTGTGG - Intronic
1121838017 14:97109323-97109345 GCTAGGCATGCACCATCTTGAGG + Intergenic
1132728244 16:1348090-1348112 CCTCGGCAGGCACGGAACTGCGG - Exonic
1133446781 16:5868036-5868058 CCAAGGCATGAAAGGAATTGTGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142702804 17:1674400-1674422 CCTAGCCTTGCAGGGTACTGAGG - Intronic
1148860886 17:50603842-50603864 CCTAGAGATGCAGTGTATTGTGG - Intronic
1151577530 17:74960199-74960221 CATAGGCACACACGGTGTTGAGG + Exonic
1159709255 18:71734118-71734140 TCTAGGCATGGAGGCTATTGAGG + Intronic
1167399452 19:49255311-49255333 CCGAGGCATGGAGGGTAGTGTGG + Intergenic
927916432 2:26939464-26939486 CGTAGTCATGAACGGCATTGGGG + Intronic
938328354 2:130428969-130428991 CATAGGTATGCCCGGTGTTGCGG - Intergenic
938361594 2:130692525-130692547 CATAGGTATGCCCGGTGTTGCGG + Intergenic
944020994 2:195103876-195103898 ACTAGGCTTGCTTGGTATTGAGG + Intergenic
947326285 2:228981786-228981808 CCTAGGCATTCACTTTATTAGGG + Intronic
1174520794 20:51129019-51129041 TCCAGGCATGCACAGCATTGTGG + Intergenic
1183189304 22:36311525-36311547 CCTCGGCATTCCTGGTATTGCGG - Intronic
1185318986 22:50191691-50191713 TCTAGTCGTGCAAGGTATTGTGG - Intronic
954901080 3:54020652-54020674 GCTGGGCTTGCACGGCATTGTGG + Intergenic
958912445 3:100009486-100009508 CATAGGCAAGCACGGTATAGGGG + Intronic
970066706 4:12103269-12103291 CCTATGCATGCACAATCTTGTGG - Intergenic
983655439 4:170079185-170079207 CCTAGGCATTCAGGGAATTCAGG + Intronic
1011062915 6:83292413-83292435 CCTAGGCAAACAGGGTATGGAGG - Intronic
1016820467 6:148342141-148342163 CCTAGCAATGCATGGCATTGTGG + Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1018357535 6:163034270-163034292 ATTAGGCATGTACGGGATTGTGG - Intronic
1035708226 8:1693973-1693995 CCTAGGCAGGCACTGTCTTTAGG + Intronic
1055165243 9:73184257-73184279 CCTAGGCATGAAAAATATTGGGG + Intergenic
1194012407 X:88578816-88578838 CCTAAACATACAAGGTATTGAGG + Intergenic
1199189050 X:144949521-144949543 CCTAGGCCAGCACAGTAGTGGGG - Intergenic