ID: 1121446551

View in Genome Browser
Species Human (GRCh38)
Location 14:93982543-93982565
Sequence TTCCCAAGGGTGATTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121446551_1121446562 30 Left 1121446551 14:93982543-93982565 CCTGTCTGAATCACCCTTGGGAA No data
Right 1121446562 14:93982596-93982618 CACAGGCCCAAGTTAGCTGCTGG No data
1121446551_1121446556 5 Left 1121446551 14:93982543-93982565 CCTGTCTGAATCACCCTTGGGAA No data
Right 1121446556 14:93982571-93982593 GGACAAAATTAAACCCTGAGTGG No data
1121446551_1121446557 13 Left 1121446551 14:93982543-93982565 CCTGTCTGAATCACCCTTGGGAA No data
Right 1121446557 14:93982579-93982601 TTAAACCCTGAGTGGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121446551 Original CRISPR TTCCCAAGGGTGATTCAGAC AGG (reversed) Intergenic