ID: 1121447868

View in Genome Browser
Species Human (GRCh38)
Location 14:93989536-93989558
Sequence GCATCTGGATGAAATCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121447868_1121447871 -3 Left 1121447868 14:93989536-93989558 CCATCAGGATTTCATCCAGATGC No data
Right 1121447871 14:93989556-93989578 TGCAATGATTCTCCTGGCTTTGG No data
1121447868_1121447872 -2 Left 1121447868 14:93989536-93989558 CCATCAGGATTTCATCCAGATGC No data
Right 1121447872 14:93989557-93989579 GCAATGATTCTCCTGGCTTTGGG No data
1121447868_1121447869 -9 Left 1121447868 14:93989536-93989558 CCATCAGGATTTCATCCAGATGC No data
Right 1121447869 14:93989550-93989572 TCCAGATGCAATGATTCTCCTGG No data
1121447868_1121447874 18 Left 1121447868 14:93989536-93989558 CCATCAGGATTTCATCCAGATGC No data
Right 1121447874 14:93989577-93989599 GGGATACTTAGAATTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121447868 Original CRISPR GCATCTGGATGAAATCCTGA TGG (reversed) Intergenic