ID: 1121449404

View in Genome Browser
Species Human (GRCh38)
Location 14:93997883-93997905
Sequence CAGCCCGAAGACCTTGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121449393_1121449404 20 Left 1121449393 14:93997840-93997862 CCCCTGCAGAATGGCACCCTCAA No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449399_1121449404 3 Left 1121449399 14:93997857-93997879 CCTCAACCTCTCCAGAGCTGGGG No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449402_1121449404 -8 Left 1121449402 14:93997868-93997890 CCAGAGCTGGGGATGCAGCCCGA No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449394_1121449404 19 Left 1121449394 14:93997841-93997863 CCCTGCAGAATGGCACCCTCAAC No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449397_1121449404 4 Left 1121449397 14:93997856-93997878 CCCTCAACCTCTCCAGAGCTGGG No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449395_1121449404 18 Left 1121449395 14:93997842-93997864 CCTGCAGAATGGCACCCTCAACC No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data
1121449401_1121449404 -3 Left 1121449401 14:93997863-93997885 CCTCTCCAGAGCTGGGGATGCAG No data
Right 1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121449404 Original CRISPR CAGCCCGAAGACCTTGGACT TGG Intergenic
No off target data available for this crispr