ID: 1121451996

View in Genome Browser
Species Human (GRCh38)
Location 14:94014605-94014627
Sequence AAGACGCTTCCAGCAACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121451994_1121451996 13 Left 1121451994 14:94014569-94014591 CCAGGTCTTGGCTTTATTCTCAG No data
Right 1121451996 14:94014605-94014627 AAGACGCTTCCAGCAACCTCAGG No data
1121451993_1121451996 14 Left 1121451993 14:94014568-94014590 CCCAGGTCTTGGCTTTATTCTCA No data
Right 1121451996 14:94014605-94014627 AAGACGCTTCCAGCAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121451996 Original CRISPR AAGACGCTTCCAGCAACCTC AGG Intergenic
No off target data available for this crispr