ID: 1121452257

View in Genome Browser
Species Human (GRCh38)
Location 14:94016479-94016501
Sequence GCTGCTCCTGAGCCAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121452257_1121452268 25 Left 1121452257 14:94016479-94016501 CCTGCTCTTGGCTCAGGAGCAGC No data
Right 1121452268 14:94016527-94016549 CCAGGCTGTAAGTGCCAGTCTGG No data
1121452257_1121452264 7 Left 1121452257 14:94016479-94016501 CCTGCTCTTGGCTCAGGAGCAGC No data
Right 1121452264 14:94016509-94016531 CTTGGGAGGCCTGTGCTCCCAGG No data
1121452257_1121452260 -10 Left 1121452257 14:94016479-94016501 CCTGCTCTTGGCTCAGGAGCAGC No data
Right 1121452260 14:94016492-94016514 CAGGAGCAGCCAGGCCACTTGGG No data
1121452257_1121452261 -7 Left 1121452257 14:94016479-94016501 CCTGCTCTTGGCTCAGGAGCAGC No data
Right 1121452261 14:94016495-94016517 GAGCAGCCAGGCCACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121452257 Original CRISPR GCTGCTCCTGAGCCAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr