ID: 1121456594

View in Genome Browser
Species Human (GRCh38)
Location 14:94042575-94042597
Sequence GGCCCTTGGAGCAGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121456587_1121456594 11 Left 1121456587 14:94042541-94042563 CCATGCAGGGACAGAGTGGCTAG 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1121456594 14:94042575-94042597 GGCCCTTGGAGCAGCCCTGGAGG 0: 1
1: 0
2: 6
3: 57
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121456594 Original CRISPR GGCCCTTGGAGCAGCCCTGG AGG Intronic
900202703 1:1418282-1418304 GCCCCGTGGAGCATCCCTGCGGG - Intergenic
900346351 1:2212349-2212371 GCCCCTTGGAGCAGCTCTGCGGG - Intronic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900483414 1:2910261-2910283 AGCCCTTGGGGCAGAGCTGGTGG - Intergenic
900486725 1:2926183-2926205 GGCCCTTGAAGCTTCCCTGTTGG + Intergenic
900793493 1:4694075-4694097 GCCACCAGGAGCAGCCCTGGGGG - Intronic
900981366 1:6047957-6047979 AGCCCTGGGAGCAGACCTGCAGG - Intronic
901181372 1:7344176-7344198 GACCCTTGGAGCCGGCCTGAAGG + Intronic
903032354 1:20472928-20472950 GACCTTTGGAGCAGTCCTTGGGG - Intergenic
903037205 1:20500600-20500622 GGCCTTTGGAGGAGCAGTGGTGG - Exonic
903522204 1:23959489-23959511 CGCCCTTGGGACTGCCCTGGGGG - Intronic
903884341 1:26532144-26532166 GGCCCAGGGTGCAGCCCAGGTGG + Intronic
904997481 1:34642236-34642258 GGCTCTTGGAACAGCCCAGGAGG - Intergenic
905132117 1:35769381-35769403 GGGCCTGGGAGGGGCCCTGGAGG - Intronic
905297164 1:36961540-36961562 GGCCCCAGGCACAGCCCTGGGGG + Intronic
905921231 1:41720243-41720265 GGGCCTGGGAGCAGCCCTGGAGG - Intronic
905923586 1:41734574-41734596 GGCCCTTTGGGCTGCCATGGCGG + Intronic
906534513 1:46544163-46544185 CTCCCTTGGAGCAGCCCCGGCGG + Intergenic
909888564 1:80973596-80973618 GGCCATTGGAGCTGCCCAGGTGG + Intergenic
911055968 1:93708828-93708850 TGTCCTTGGCACAGCCCTGGCGG - Intronic
911337330 1:96596405-96596427 GCCCCTAGGGGCAGACCTGGAGG - Intergenic
912500947 1:110121548-110121570 GGCCCTTGGAGCCGTCCTGCTGG + Intergenic
912793309 1:112674554-112674576 GGCCCTCTGAACAGCCCGGGAGG - Exonic
913548531 1:119894295-119894317 GCCCCTCTGAGCAGTCCTGGAGG + Exonic
914215712 1:145626211-145626233 TGCCCTGTCAGCAGCCCTGGGGG - Intronic
914467658 1:147946596-147946618 TGCCCTGTCAGCAGCCCTGGGGG - Intronic
915071503 1:153272627-153272649 GGCCATAGGAGCTGGCCTGGAGG + Intergenic
915092869 1:153438791-153438813 GGTTCTTGAAGCAGCCCAGGAGG - Intronic
915165831 1:153947156-153947178 AGCCCTTGGACCAGCCGTGTGGG - Intergenic
915599347 1:156912855-156912877 GTCCCTTGTGGTAGCCCTGGTGG + Exonic
917742001 1:177969907-177969929 GGTCCCTGGAGCAGCGCTGAAGG - Exonic
917906657 1:179592035-179592057 GGCCCTTCCACCTGCCCTGGCGG - Exonic
919388676 1:196954374-196954396 GCCCATGAGAGCAGCCCTGGGGG - Intronic
919801791 1:201358846-201358868 GGCCCAGGGTGCAGCCCAGGAGG - Intergenic
919982451 1:202650785-202650807 AGCCCTTGGAGCCTCCATGGGGG + Intronic
922050972 1:221990404-221990426 GGCCCCTGAGGGAGCCCTGGTGG - Intergenic
922507097 1:226132929-226132951 GGCCCTGGGAGCTGCCAGGGCGG - Intergenic
922531737 1:226350131-226350153 GCCCCATGCTGCAGCCCTGGAGG - Intergenic
922539374 1:226407685-226407707 GGCCCTCGGAGCGGCACTTGGGG - Intronic
923100331 1:230809265-230809287 GGCCCCTGGGGAAGACCTGGTGG - Intergenic
923147767 1:231209923-231209945 GGCCTCAGGGGCAGCCCTGGAGG - Intronic
924385327 1:243494018-243494040 GGTCCTTCCAGGAGCCCTGGGGG + Intronic
1063267976 10:4475240-4475262 GGCTCTTGGGGCATCCCAGGAGG + Intergenic
1063404058 10:5775873-5775895 GGCCCGTGGAGCAGTGCTGGAGG + Intronic
1067040677 10:42951745-42951767 GGCCCCTGGCGCAGCCTGGGTGG - Intergenic
1067274557 10:44822105-44822127 AGCCCTGGGGGCAGCCCTGTGGG - Intergenic
1069795430 10:71048890-71048912 GATCCTTGGAGCAGTCCTGAGGG + Intergenic
1070231977 10:74578011-74578033 GGCCATTAGAGTAGCCCTGGAGG + Intronic
1071502318 10:86212592-86212614 GGCTCGTGGAGCAGCCTTGGGGG - Intronic
1071554701 10:86593161-86593183 GGCCCTTGGGACAGGCCTGCTGG + Intergenic
1071611813 10:87038717-87038739 GGCCCTGGGAGCTGCCCCGGGGG + Intergenic
1071677321 10:87666844-87666866 GGGACTTGGAGGAGCTCTGGGGG + Intronic
1072426676 10:95336244-95336266 GGCCCTTGCAGCAGGCCAGGAGG + Intronic
1073078325 10:100838646-100838668 GGCTCTTGGAACACCCTTGGAGG - Intergenic
1075018433 10:118928432-118928454 GGCCCTTGAAGCAACTCAGGGGG + Intergenic
1075115292 10:119621027-119621049 GGCCCCAGGAGCATCCCTTGGGG + Intergenic
1075256050 10:120926729-120926751 GGGCCAGGGAGCAGCCCTGCAGG + Intergenic
1075574083 10:123565916-123565938 GGACCTCGGAGCTGCCATGGTGG - Intergenic
1075672650 10:124273061-124273083 GGGCCATGGAACAGCCTTGGAGG - Intergenic
1076587513 10:131559669-131559691 GGCCCATGGAGCTGCGGTGGAGG + Intergenic
1076670095 10:132115821-132115843 CAACCTTGGAGCAGCCCTGAGGG + Intronic
1077145058 11:1040961-1040983 GGCCCTTGCAGCTGCCCTTCCGG - Intergenic
1077215396 11:1393369-1393391 GGCCCTTGGAGCTGTTCTTGGGG + Intronic
1077316763 11:1922753-1922775 GGGTCTTGGAGCAGCGCTGTGGG - Intronic
1077326458 11:1966039-1966061 GGGCCCCGGAGCAGGCCTGGTGG + Intronic
1077392324 11:2305732-2305754 GGCCTGTAGAGCAGCCTTGGAGG + Intronic
1078216216 11:9314291-9314313 GGCCCGGGGAGCAGAGCTGGGGG - Intronic
1079155798 11:17946925-17946947 GGCACTTGGAGAAGCCTTGGGGG - Intronic
1079341637 11:19616602-19616624 GGCACGTGGAGCAACCCTGGGGG - Intronic
1080749956 11:35142107-35142129 GGCCCTTGGTGGAGGCCAGGGGG + Intronic
1081853914 11:46292019-46292041 GGCCGAGAGAGCAGCCCTGGCGG + Intronic
1082091040 11:48090147-48090169 TGGCCTGGGAGCAGCCCTCGAGG + Intronic
1083313173 11:61796354-61796376 GGCCCTGGGTGCTGCCTTGGCGG - Exonic
1083610563 11:64002362-64002384 GGCCTTTGGGGCTGACCTGGGGG + Intronic
1083866313 11:65455436-65455458 GGCCCATGTAGCATCCCTGGAGG + Intergenic
1084093473 11:66894621-66894643 GGCCTTTGGAGGATTCCTGGTGG - Intronic
1084629855 11:70340919-70340941 GGACCCTAGAGCAGCCCCGGTGG - Intronic
1084630459 11:70345016-70345038 GGACCCTAGAGCAGCCCCGGTGG - Intronic
1084920945 11:72469185-72469207 GGCCCCTGGGGCAGCTCTGCTGG + Intergenic
1085397758 11:76215612-76215634 GGCTCAGGGAGCAGGCCTGGGGG + Intergenic
1086954048 11:92917286-92917308 GGCCCATGCAGGAGTCCTGGAGG + Intergenic
1086993457 11:93330681-93330703 GCCCCTTGGGGCGGGCCTGGCGG + Intronic
1087136291 11:94723954-94723976 AACCCTTGGAGCAGCCCAGGAGG + Intronic
1088626682 11:111734823-111734845 GGGCCTTCGCGCTGCCCTGGGGG - Intronic
1089195771 11:116693291-116693313 GGCCAAGGGGGCAGCCCTGGAGG + Intergenic
1089213075 11:116819597-116819619 GGCCCCTGGTGCTGGCCTGGTGG - Intergenic
1089883303 11:121795394-121795416 GGCTGTGGGAGCAGGCCTGGAGG - Intergenic
1089929264 11:122293328-122293350 GGCCCTTGGAGCATCAGTGTTGG + Intergenic
1090333552 11:125948435-125948457 AGGCCTTGGAGAGGCCCTGGTGG + Intergenic
1090391488 11:126391640-126391662 GGACCTTGTAGCAGCCAGGGAGG - Intronic
1202809439 11_KI270721v1_random:21218-21240 GGGCCCCGGAGCAGGCCTGGTGG + Intergenic
1091550517 12:1531805-1531827 GGCCCCTGGAGCAGTCTGGGGGG - Intronic
1092822548 12:12366043-12366065 GGCCCCTGCAGCAGCCCAGCAGG - Intronic
1093233133 12:16573717-16573739 GACCCCTGAAGCAGCCCTGAGGG + Intronic
1093461687 12:19412885-19412907 GGTCCCTGGCGCTGCCCTGGCGG + Intronic
1094564933 12:31590834-31590856 GGCCCCTGGAGCAGCGCGGCCGG - Exonic
1095517024 12:43017194-43017216 GCCCCCAGGGGCAGCCCTGGAGG - Intergenic
1096747038 12:53735795-53735817 GGCCCCAGGAACAGCACTGGGGG - Intergenic
1099978330 12:89569936-89569958 AGCCCTTGGGGCAGCCCGGGAGG + Intergenic
1100538218 12:95532102-95532124 GGACCAAGGAGTAGCCCTGGAGG - Intronic
1101032281 12:100672164-100672186 GGCCCTGGGTGCAGCTCTGGTGG + Intergenic
1102453431 12:113057283-113057305 TTCCCTTGGGGCAGGCCTGGAGG - Intronic
1103096540 12:118136713-118136735 GGCCCTAGGGGAAGCTCTGGGGG - Intronic
1103649736 12:122422913-122422935 GCCCCTCGGAGCAGGCCTGTGGG - Intergenic
1104595179 12:130115828-130115850 TGCCCTTGGGCCAGCCCAGGGGG - Intergenic
1104949653 12:132433721-132433743 GGCCCTGGGAGCAGACCCGGGGG - Intergenic
1105440993 13:20415315-20415337 GACCCCTGGGGCTGCCCTGGAGG - Intronic
1105491346 13:20891573-20891595 GGCTCTTGGGCCAGCCGTGGTGG + Intronic
1106835309 13:33627812-33627834 GCCCCACGGTGCAGCCCTGGAGG - Intergenic
1108524867 13:51278155-51278177 GTCACTTGGAGCAGCTCAGGAGG + Intronic
1108619587 13:52168305-52168327 GGCCCATGGGGCAGCCTTTGAGG - Intergenic
1111245267 13:85529945-85529967 GGCCATTGTAGCAGCCCTGAAGG - Intergenic
1112208339 13:97347465-97347487 GCTCCTTGGAGCAGCCACGGAGG + Intronic
1112779382 13:102882423-102882445 TGCCCTTGGAGCAGATCAGGTGG + Intergenic
1113600151 13:111562912-111562934 GGCCATGGCTGCAGCCCTGGGGG + Intergenic
1113664859 13:112134454-112134476 GGCCTGTGGAGGAGCCCAGGAGG + Intergenic
1113942380 13:114024981-114025003 GGCCCTTGCAGCAGAGCAGGAGG + Intronic
1114673113 14:24423570-24423592 GGCCATGGGAGCAGAACTGGTGG + Intergenic
1115478918 14:33842586-33842608 GTCCCTGGGAGCAGCCCTAGGGG + Intergenic
1118317146 14:64732315-64732337 GGGCCTTGGTGCAGCACTGTGGG + Intronic
1118614006 14:67562816-67562838 GGCCCTTGGAGCTGAGCTGGAGG + Exonic
1119072956 14:71606339-71606361 GGCCCATGCTTCAGCCCTGGTGG + Intronic
1120877433 14:89387933-89387955 AGCACTTGGGGCAGCCCAGGTGG + Intronic
1121283142 14:92713793-92713815 AGCCCTTGGGGCAGCCTTGTGGG - Intronic
1121408276 14:93732627-93732649 GGCACCTGGCCCAGCCCTGGCGG + Intronic
1121456594 14:94042575-94042597 GGCCCTTGGAGCAGCCCTGGAGG + Intronic
1121533900 14:94677939-94677961 GGCTCTTGGACTAGCCCTGCAGG + Intergenic
1122295733 14:100704730-100704752 GTCCCTTGGACCAGCTCAGGTGG - Intergenic
1122406854 14:101505852-101505874 GGCCGTTGCAGCAGCCCCGCTGG + Intergenic
1122789467 14:104178278-104178300 GTCCCTTGGGGCAGCCCTGGCGG - Intronic
1124439780 15:29677647-29677669 GCCCCTGGCAGCAGTCCTGGAGG + Intergenic
1124621534 15:31276790-31276812 GCCCCTTGGGGAAGGCCTGGAGG + Intergenic
1125717888 15:41830048-41830070 GGCTCTGGGAGCAGCAGTGGTGG + Intronic
1127385457 15:58463057-58463079 TGCCCCTGGAGCAGCACTGGGGG + Intronic
1128527582 15:68422970-68422992 GGCCCTGGGAGATGCTCTGGGGG - Intronic
1128728460 15:70005013-70005035 GGGCCCTGGAGCAGCTCTGTTGG + Intergenic
1128739283 15:70072560-70072582 TGGCCCTGGTGCAGCCCTGGAGG - Intronic
1128944007 15:71809494-71809516 GGACCTGGGAGCAGCGCAGGGGG + Intronic
1129371530 15:75098902-75098924 TGCCCTTGCAGCAGCTCTGAGGG - Intronic
1129671828 15:77611958-77611980 GGCCCTGGGAAGAACCCTGGTGG + Intergenic
1130104598 15:80919893-80919915 GGCCCTGGGAGGAGCACTGGAGG - Intronic
1130145610 15:81271700-81271722 GGCCCGTGGAGGAGCCCTGAAGG + Intronic
1130554663 15:84914427-84914449 TGCCCTGGGAACAGTCCTGGAGG - Intronic
1131974049 15:97924286-97924308 GGCCCTTGGAGCATGCCCAGTGG - Intergenic
1132317371 15:100899804-100899826 GTCCCTTGGAGCAGCCCCTGTGG + Intronic
1132383411 15:101382358-101382380 GGACCTTTGAGCAGCCCTCAGGG - Intronic
1132462411 16:62031-62053 GGCCCTTGGAGCGAGGCTGGCGG - Exonic
1132471263 16:104755-104777 GGCCTTTGGGGCACTCCTGGTGG - Intronic
1132552545 16:559534-559556 GGAACTTGGTGCAGCCCGGGAGG + Intergenic
1132554999 16:568468-568490 GGCCCTTGGATCACCGCGGGAGG + Exonic
1132583479 16:695557-695579 TGACCTTGGAGCAGCCCGAGAGG + Exonic
1132599708 16:768077-768099 GGCAAGTGGAGAAGCCCTGGTGG + Intronic
1132627503 16:898516-898538 GGGGCCTGGAGCAGCCCAGGTGG + Intronic
1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG + Exonic
1133019433 16:2960713-2960735 GACCCTGAGAGCAGCCCTGGGGG - Intergenic
1133138424 16:3728260-3728282 GGCCCATGGAGCTGCCCTGGAGG + Exonic
1134040675 16:11065990-11066012 GGGCCTTCGAGCTGCACTGGGGG + Intronic
1134317727 16:13134825-13134847 GGCCCATGGAGCAGAGCTAGAGG - Intronic
1134521599 16:14921413-14921435 AGCCATTGGCGCAGGCCTGGGGG - Intronic
1134709270 16:16320064-16320086 AGCCATTGGCGCAGGCCTGGGGG - Intergenic
1134950335 16:18348581-18348603 AGCCATTGGCGCAGGCCTGGGGG + Intergenic
1135201560 16:20441977-20441999 GGTTCTGGGAGCAACCCTGGAGG + Intergenic
1135217548 16:20585889-20585911 GGTTCTGGGAGCAACCCTGGAGG - Intergenic
1135600115 16:23775730-23775752 GCCCCTTGGAGCAGCCCAGCTGG + Intergenic
1135993860 16:27233884-27233906 GGCACTTGGAGCAGCCAGGCAGG + Intronic
1136536393 16:30902323-30902345 GGCCCTGGGCGCCGCCGTGGAGG + Exonic
1136559457 16:31030481-31030503 GGCCCTCTGAGCAGCCTTGACGG - Intergenic
1138194712 16:55043653-55043675 GGGGCTTGGAGAAGCCCAGGGGG + Intergenic
1138263589 16:55643613-55643635 GGCCCTTGGAACAGGCAGGGTGG + Intergenic
1140317536 16:73913603-73913625 GGCCCTTGAAGCTGGCCTGTGGG - Intergenic
1142596478 17:1032129-1032151 GGCCCCTGGAGCAGCCCGGTGGG - Intronic
1142611564 17:1111393-1111415 GGCCCTCGGTGCCCCCCTGGAGG + Intronic
1143024543 17:3933788-3933810 GGCACATGGGGAAGCCCTGGAGG + Intronic
1143404980 17:6671347-6671369 GGCCTTTGGTGAGGCCCTGGTGG - Intergenic
1143619729 17:8073973-8073995 GGGGCCAGGAGCAGCCCTGGAGG - Intronic
1143683139 17:8492383-8492405 GGCCCTCGAGGAAGCCCTGGAGG - Exonic
1144319252 17:14097844-14097866 GTCCCTTGGAGTATCCCTGGGGG + Intronic
1145305242 17:21670452-21670474 GGTCCTTGGAACAGCACTGGGGG + Intergenic
1145736156 17:27233187-27233209 GGCCCCTTGAGCATCCCTAGTGG - Intergenic
1145994785 17:29099058-29099080 GGCCAGAGGAGCAGCCCTGGGGG - Intronic
1146290257 17:31601625-31601647 GGCCCTTGCAGAAGCCCATGTGG - Intergenic
1146438920 17:32876909-32876931 GGCCCACGGAGCGGCCCCGGAGG - Exonic
1146859460 17:36284394-36284416 GGCCCTTGGACCAGCCTGGTAGG - Intronic
1147089784 17:38088481-38088503 GGCCCTTGGACCAGCCTGGTAGG - Intergenic
1147107427 17:38232039-38232061 GGCCCTTGGACCAGCCTGGTAGG + Intergenic
1147154447 17:38536630-38536652 GGCCCTGGGAATGGCCCTGGAGG - Intronic
1147660592 17:42115020-42115042 TGTCCTTGGAGAAACCCTGGGGG + Exonic
1147704562 17:42417006-42417028 GGCACTTGGAGCAGGTCTGATGG + Intronic
1147893493 17:43734221-43734243 GGCTCATGGAGGAGTCCTGGAGG + Intergenic
1147969232 17:44210743-44210765 GGCCCTGGCAGCCCCCCTGGGGG + Intronic
1148421971 17:47555810-47555832 GGCCCTTGGACCAGCCTGGTAGG - Intronic
1148476013 17:47929151-47929173 GGCCCTTGGAGGTGCTCTGGGGG - Intergenic
1149696188 17:58617976-58617998 GGACATTCAAGCAGCCCTGGGGG + Intronic
1150133403 17:62681069-62681091 GGGCCCAGGAGCAGCACTGGTGG + Exonic
1150170230 17:62986683-62986705 GGCCTTTGAAGCAGCCCTGTGGG - Intergenic
1151349841 17:73525244-73525266 GGCCCCAGAAGCAGCCCTCGAGG + Intronic
1151515227 17:74589836-74589858 AGCACTTGAAGAAGCCCTGGGGG + Intronic
1151946225 17:77321371-77321393 GGCCCTGGGAGCAGTGGTGGAGG - Intronic
1152007973 17:77694484-77694506 GGCTCTTGTAGCTGCCCTGTGGG + Intergenic
1152231645 17:79116980-79117002 GGCCTGAGAAGCAGCCCTGGTGG + Intronic
1152534247 17:80941254-80941276 GGGGCAGGGAGCAGCCCTGGAGG + Intronic
1152552021 17:81034820-81034842 GGCCCTGGGAGCAGCCTGAGGGG - Intergenic
1152607759 17:81301617-81301639 TGCCCTTGCAGCAGCCATGTCGG - Intergenic
1152758113 17:82095544-82095566 GGCCCCTGGAGGGGCCATGGTGG + Intronic
1152783619 17:82237088-82237110 GGGCTTTGGGGCAGCCTTGGGGG + Intronic
1152844503 17:82591457-82591479 GCCCCATGGAGAAGGCCTGGAGG + Intronic
1152859163 17:82685547-82685569 GCCCCTAGGACCTGCCCTGGAGG - Intronic
1153627885 18:7038863-7038885 AGCACTCGGAGCAGCCCCGGGGG + Exonic
1154375764 18:13808451-13808473 GGCCCTGGGAGCTCACCTGGAGG - Intergenic
1157527258 18:48393271-48393293 GGTGGTTGGAGCAGGCCTGGTGG - Intronic
1157559888 18:48638588-48638610 GGCCCATGGAGCAGGGCTGGGGG + Intronic
1157603856 18:48913350-48913372 TGCCCTTGGAGGACACCTGGTGG + Intergenic
1158546122 18:58398876-58398898 TGCCCGGGGAGTAGCCCTGGGGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160418389 18:78727536-78727558 GGCTCATGGCGCAGCCTTGGCGG + Intergenic
1160864592 19:1251150-1251172 GGCCCGAGGAGAGGCCCTGGGGG - Intronic
1160871223 19:1278795-1278817 GGCCCTTCCAGCAGCCATGAGGG + Exonic
1160879183 19:1311770-1311792 GGCCCCTGCAGCATCCATGGCGG + Intergenic
1160922949 19:1529154-1529176 GGCCCTTGGGAAAGCCCAGGTGG - Intronic
1160996594 19:1884993-1885015 GCCCCTGGGAGCTGCCTTGGGGG + Intronic
1161429683 19:4224368-4224390 GGGACTTGGGGCAGCCATGGAGG + Intronic
1163434239 19:17285683-17285705 GCACCTTGGGGCAGGCCTGGTGG - Exonic
1163455342 19:17403183-17403205 GGCCTCTGGAGCAGGTCTGGAGG - Exonic
1163690308 19:18735096-18735118 GGCCCTTGGAGGAGCACAGGAGG + Intronic
1163787007 19:19279929-19279951 GGCCCTTGGGGCGGCCCCGGTGG - Intronic
1163793146 19:19320174-19320196 GGAGGTTGGAGCAGCCCTGAAGG + Intronic
1164574218 19:29396272-29396294 GGCTCCTGGAACAGCCCTGGGGG + Intergenic
1165454744 19:35903971-35903993 GGCCCTTGGGGAAGCCCTGGAGG + Intronic
1166303008 19:41922696-41922718 GGCCCTTGTGGGATCCCTGGTGG - Intronic
1166807685 19:45496946-45496968 GGCGGCTGGAGCAGCCCGGGAGG - Exonic
1167013874 19:46826919-46826941 GGCAGTTCCAGCAGCCCTGGTGG - Intergenic
1167281951 19:48574443-48574465 TGCCCTTGGAGAGGCCCTGAAGG - Intronic
1167410087 19:49339323-49339345 GGCCCTGCGCGCAGCCCTGGGGG - Exonic
1167517384 19:49930973-49930995 GGTCCTTGGGGGAGCCCTGGAGG + Exonic
1167713350 19:51125538-51125560 GATCCATGGTGCAGCCCTGGGGG - Intronic
1167942247 19:52957278-52957300 GCCCTTTGGAGCATCCCTGCTGG + Intronic
1168077073 19:53986764-53986786 GGTCCTTGGAGTAGACCTTGTGG + Exonic
1168254925 19:55159927-55159949 GGCCGTTGTAGCAGCTCTTGTGG + Exonic
925385546 2:3459469-3459491 TCCCCTGGGAGCTGCCCTGGGGG - Intronic
925390385 2:3490311-3490333 GGTCCTGGGAGGAGCCCTGAGGG - Intergenic
925390395 2:3490336-3490358 GGTCCTGGGAGGAGCCCTGGGGG - Intergenic
926249042 2:11142949-11142971 GGCACTTTGAGAAGCCTTGGCGG - Intronic
927115990 2:19902361-19902383 GGACCGTGGAACAGACCTGGTGG - Intergenic
928300894 2:30122618-30122640 GGGGCTTGGAGGAGGCCTGGTGG + Intergenic
928364693 2:30691903-30691925 AGGCCTTGGGGCATCCCTGGGGG + Intergenic
931208174 2:60167607-60167629 TTCCCTTTGAGGAGCCCTGGTGG - Intergenic
933714730 2:85351611-85351633 GAGGCTTGGAGCAGCCCTTGTGG - Intronic
934692563 2:96372913-96372935 GGGCCTTGGAACACCCCTCGAGG + Intronic
936167936 2:110140044-110140066 GGGCCTTGCAGCAGGGCTGGGGG - Intronic
936462722 2:112724314-112724336 GGCCCTGGGAGGAGCCTTTGGGG + Intronic
937906896 2:127056861-127056883 GGCTCTTGGCTCAGCCGTGGAGG - Intronic
937994137 2:127680184-127680206 GGCCCAGGGAGCCGCCCGGGAGG - Intronic
938169962 2:129066816-129066838 GGCCCTGGGAGCCTCCGTGGTGG + Intergenic
939046187 2:137252643-137252665 GCCTATTGGAGCAGCCCTTGAGG + Intronic
940883254 2:158968334-158968356 GGGCCTAGGCGCAGCCCCGGGGG + Intergenic
943179358 2:184524102-184524124 AGCCCTTTGGGGAGCCCTGGGGG - Intergenic
943348242 2:186766688-186766710 GGCCCCTGGAGGAGCCATAGGGG + Intergenic
946053796 2:216884337-216884359 GCACCTTGGAGGATCCCTGGTGG + Intergenic
948707983 2:239807015-239807037 GCCCCTTGCAGCACCCGTGGGGG - Intergenic
948741079 2:240046380-240046402 GTCCCTTGGAGAAGTCCAGGTGG - Intergenic
948838442 2:240637312-240637334 GGCCGTGGGAGCAGGTCTGGAGG - Intergenic
948859733 2:240746997-240747019 GGACCCTGGAGCGGCCGTGGTGG + Intronic
1169389777 20:5180360-5180382 GGCCCTTAGAGCAGCCCCGAGGG + Intronic
1169969268 20:11251384-11251406 GGCCCTTGAAGCAGCTCCGGGGG - Intergenic
1171522760 20:25787925-25787947 GGTCTTTGGAACAGCACTGGGGG + Intronic
1171554067 20:26067958-26067980 GGTCTTTGGAACAGCACTGGGGG - Intergenic
1171767568 20:29298408-29298430 GGCCCTCAGAGCAGCCCCGCCGG - Intergenic
1171865702 20:30486232-30486254 GGCCCTCGGATCAGCCCCGCTGG - Intergenic
1172284506 20:33731630-33731652 GGTCCGTGCAGCAGACCTGGAGG + Intergenic
1172635093 20:36404987-36405009 GGGCCTTGCTGCAGACCTGGGGG + Intronic
1173568111 20:44056161-44056183 GTCCCCTGGAGCAGCTCTGAAGG - Intronic
1174396680 20:50251055-50251077 GGCCCGGGGACCTGCCCTGGAGG + Intergenic
1175201815 20:57283315-57283337 GGCCCTTTGCTCAGCCCTGGTGG + Intergenic
1175265698 20:57702175-57702197 GGCCCTGGGAACAGCACCGGAGG + Intronic
1175484858 20:59338528-59338550 GGCCTCTGGAGCTGGCCTGGGGG - Intergenic
1175547287 20:59786475-59786497 AGCCCAGGGAGCAGCCCTGGGGG + Intronic
1175996631 20:62814946-62814968 GCCTGTTGGAGCAGCCCTGGGGG + Intergenic
1178555706 21:33588491-33588513 GGCCCGCCGAGCCGCCCTGGTGG - Exonic
1179095999 21:38314762-38314784 GGGCCTGGGAGCAGCCCAGTTGG - Intergenic
1179531447 21:42022304-42022326 GGCCCCTGGCAGAGCCCTGGAGG + Intergenic
1179730381 21:43364234-43364256 GGCCGCTGGAGCAAGCCTGGTGG - Intergenic
1179845395 21:44108009-44108031 GGGCCGTGGAGCCGGCCTGGGGG + Intronic
1180038852 21:45265452-45265474 GGTCCGGGGAGCGGCCCTGGAGG + Exonic
1180042811 21:45288543-45288565 GGCCCTCCAAGGAGCCCTGGAGG + Intergenic
1180090333 21:45530989-45531011 GGGCGTTGCAGCGGCCCTGGGGG + Intronic
1180835314 22:18926733-18926755 GGCCCCCGGAGCAGCTCTGAGGG + Intronic
1180858068 22:19060600-19060622 GGCCCTGGGAGCAGCACGTGGGG + Intronic
1181013197 22:20054121-20054143 GGCCCATGGACCTGCCCTTGTGG - Intronic
1181022441 22:20110551-20110573 GGTCCCTGTAGCAGCCCTGCAGG - Exonic
1181681765 22:24500326-24500348 TGCCCTTGGAGCACACCTGCAGG + Intronic
1181711902 22:24696340-24696362 GGTCCTGGGAGCAGCTCTGTGGG + Intergenic
1181860260 22:25812732-25812754 GGCCCTAAGAGCATCCCTGATGG + Intronic
1182504563 22:30772582-30772604 TGTCCTAGGAGCAGCCCTGCTGG + Intronic
1182550628 22:31099051-31099073 CGCCCCTACAGCAGCCCTGGCGG + Exonic
1183432495 22:37774246-37774268 GGCCCAGGCAGCAGCCATGGCGG + Exonic
1183702000 22:39456409-39456431 GGCCCTCGGAGAACCGCTGGTGG + Intergenic
1184168364 22:42743790-42743812 GGGCCTTGGAACATCCCTGGAGG + Intergenic
1184335617 22:43851475-43851497 GACCGTGGGAGCAGCCCTGGGGG + Intronic
1184405542 22:44298635-44298657 GGCCCTGGGACCAGCCCGTGAGG + Intronic
1184714549 22:46273408-46273430 GGCCCTCGCAGCAGCCTTGCTGG - Intronic
1185050323 22:48550953-48550975 GGCCCTCAGAGCAGCCCTGGTGG - Intronic
1185050340 22:48551025-48551047 TGCCCTCAGAGCAGCCCTGGGGG - Intronic
1185294768 22:50047652-50047674 GGCCCATGGTACAGGCCTGGGGG - Intronic
1185340474 22:50288659-50288681 GGCCCTTAGGACAGGCCTGGGGG - Intronic
1203285402 22_KI270734v1_random:152032-152054 GGCCCCCGGAGCAGCTCTGAGGG + Intergenic
950432413 3:12958448-12958470 GGCCCTCACAGCAGCCCTGCTGG - Intronic
950469082 3:13173556-13173578 GGCCCTTGGACAAACCCTGTGGG + Intergenic
950647613 3:14386665-14386687 GACCCTTGGAGCAGCCCTCCTGG - Intergenic
952834340 3:37590925-37590947 TGTCCTTAGCGCAGCCCTGGGGG + Intronic
953237246 3:41117578-41117600 GGCTCTTGTTGAAGCCCTGGCGG - Intergenic
953836481 3:46350442-46350464 GGCCCTTCGAGCAGGCTTGAAGG - Intergenic
954649067 3:52149166-52149188 GACCCTTGGAGGAACCCTGGGGG - Intronic
955706033 3:61728747-61728769 GGACCAGGGAGCAGGCCTGGTGG + Intronic
957021820 3:75136659-75136681 GCCCCATGGAGCATCCCTGTGGG + Intergenic
957264750 3:77948694-77948716 GGGCTTTGGAGTAGCCCTGCCGG - Intergenic
962149995 3:132882484-132882506 GACCCCTGGAGCAGCACTGTGGG + Intergenic
962874228 3:139523447-139523469 GGCACAAGGAGAAGCCCTGGAGG + Intronic
964273962 3:154988178-154988200 GGCCCGAGGAGCAGCCCATGGGG + Intergenic
965652434 3:170947608-170947630 GGCACTTGGGGCAGGACTGGTGG + Intergenic
967325447 3:188234142-188234164 AGCCCTTGGAGCAGGGGTGGGGG - Intronic
968101038 3:195965468-195965490 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
968578165 4:1377520-1377542 TGGCCTTGGGGCACCCCTGGTGG - Intronic
968620327 4:1601021-1601043 GGCCCTGGGCGTGGCCCTGGGGG - Intergenic
968642557 4:1721764-1721786 GGCCCCAGGAGGAGCCGTGGGGG - Intronic
968764727 4:2462458-2462480 GGCCCTTGCGGCGGCCCCGGCGG + Exonic
969569407 4:7999860-7999882 GGCCCCAAGAGCAGGCCTGGCGG - Intronic
971761347 4:30770071-30770093 GGCCATTGGAACAGGCTTGGTGG + Intronic
974781763 4:66561757-66561779 CGCACTGGGAGCAGCCCTGCCGG - Intergenic
975696968 4:77023067-77023089 GTCCCTTGCAGAAGCCCTGCTGG - Intronic
976646400 4:87391567-87391589 GGCACTTTGAGAAGCCCTGGCGG + Intergenic
978195513 4:105967357-105967379 TGCCCACGGAGCAGCCCTGTGGG + Exonic
983577190 4:169271535-169271557 GGCGGCGGGAGCAGCCCTGGCGG + Intergenic
983935934 4:173502588-173502610 GGCCCTGGGAGGAGTCCTGGTGG + Intergenic
985502044 5:254445-254467 AGCCCTTTGAGGAGCACTGGAGG + Exonic
985544824 5:504366-504388 GGCCCTGGCTGCAGCCCCGGGGG - Intronic
985572139 5:652764-652786 ACCCCTGGGAGCAGCCTTGGAGG - Intronic
985734974 5:1574221-1574243 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
985763715 5:1765399-1765421 GGCTGTTGCAGCAGCCCAGGTGG + Intergenic
988577881 5:32444422-32444444 CGCCGTGAGAGCAGCCCTGGCGG + Intronic
988823777 5:34914911-34914933 GGCCCCAGGAGCATCCCTCGGGG - Exonic
993886521 5:93421703-93421725 GGACAATGGAGCGGCCCTGGGGG - Intergenic
997955346 5:138274606-138274628 GTCCCTCGGACCAGCGCTGGAGG - Exonic
1001035025 5:168291568-168291590 GGCCCTAGGACCCGCCCTCGAGG + Intergenic
1001415340 5:171541617-171541639 GGCCCAGGGAGCATCCCAGGAGG - Intergenic
1001688753 5:173616430-173616452 GGCCCGGGGCGCAGCCATGGCGG - Exonic
1001849477 5:174951226-174951248 GGCCCTTGGTGCAGACTGGGTGG + Intergenic
1001936207 5:175707815-175707837 GGCTCTTGCAGCAGCTCAGGAGG - Intergenic
1004235935 6:13874184-13874206 TGCCCTAGGAGCAGCCCGGGAGG - Intergenic
1004873159 6:19928010-19928032 GGCCCTATAAGCAGCCCTGTTGG + Intergenic
1005985876 6:30874594-30874616 GCTCCATGGAGCAGCCCTGAGGG - Intergenic
1006079747 6:31558398-31558420 GGCCATGGCTGCAGCCCTGGTGG + Exonic
1006288650 6:33117239-33117261 GGCTCCTGGGGCAGCCGTGGGGG + Intergenic
1006396273 6:33789288-33789310 GGCTCTTAGAGCCGCCATGGTGG + Intergenic
1006459767 6:34151617-34151639 GGCCCTGGGAGGAGACCTGCAGG + Intronic
1012439032 6:99245145-99245167 GGTCCCTGGAGCTGCCTTGGAGG - Intergenic
1015750179 6:136550770-136550792 GGTCCGAGGAGCAGCCCAGGTGG + Intronic
1017745407 6:157442808-157442830 GCCACTTGCAGCACCCCTGGTGG + Intronic
1019064391 6:169284581-169284603 GGCACTTGGACCAGGCCTGGTGG + Intergenic
1019363986 7:621934-621956 GACCCTTCTAGCAGCACTGGGGG - Intronic
1019408215 7:895055-895077 GGGCCATGGAGCAGCCACGGGGG - Intronic
1019424485 7:967712-967734 GCCCCTCCGAGCACCCCTGGGGG - Exonic
1021624235 7:22576793-22576815 GACCCTGTCAGCAGCCCTGGAGG - Intronic
1022503509 7:30896849-30896871 GGGCCTTGGAGCTGGCCTTGTGG - Intergenic
1023017274 7:35980924-35980946 GGCCACTCAAGCAGCCCTGGTGG - Intergenic
1023200726 7:37694271-37694293 GGCTTTTGGAGCAGCTCTGCCGG + Intronic
1023820004 7:43975313-43975335 GGCCCCAGCAGCAGCCCTTGGGG - Intergenic
1024556215 7:50605307-50605329 GGCCCAGAGCGCAGCCCTGGAGG - Exonic
1024650280 7:51397720-51397742 GGCCCATGGAGCAGACGGGGAGG - Intergenic
1024659184 7:51476696-51476718 GGCCCTGGGAGCTGCGGTGGAGG + Intergenic
1026153084 7:67804389-67804411 GGCCCTTGGAGCAGCTTCAGTGG - Intergenic
1026734622 7:72941923-72941945 GGGCTGGGGAGCAGCCCTGGCGG - Exonic
1026784957 7:73296835-73296857 GGGCTGGGGAGCAGCCCTGGCGG - Intergenic
1026902263 7:74043789-74043811 GGGCCTTGGAGCTGCCTGGGTGG + Intronic
1026940300 7:74283900-74283922 AGTCCTGGGAGCAGCCCTGCAGG + Intergenic
1027109120 7:75423095-75423117 GGGCTGGGGAGCAGCCCTGGCGG + Exonic
1029748280 7:102528766-102528788 GGCCCCAGCAGCAGCCCTTGGGG - Intergenic
1029766227 7:102627853-102627875 GGCCCCAGCAGCAGCCCTTGGGG - Intronic
1030436612 7:109529884-109529906 GGCCCCTTGAGCCGCCCTTGCGG + Intergenic
1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG + Intergenic
1031387205 7:121166086-121166108 GGCCCTTGTGGCAGAGCTGGTGG - Intronic
1033039866 7:137908294-137908316 GGCCCGGGGTGCAGCTCTGGAGG + Exonic
1033672999 7:143511199-143511221 GGCCTTTGGGGCAGCGCAGGCGG + Intergenic
1034850962 7:154493144-154493166 GGCTCTTGCAGCAGCCTTGGGGG - Intronic
1034958982 7:155352576-155352598 GGCCCTCACAGCAGCCCTGAGGG - Intergenic
1035133357 7:156675978-156676000 GGCCCGGGGTGCAGCCGTGGAGG + Intronic
1035180374 7:157085040-157085062 GCCACTGGGAGCAGCCGTGGGGG + Intergenic
1035239844 7:157522343-157522365 GTCCCAGGGAGCAGCCATGGAGG + Intergenic
1035730842 8:1852800-1852822 GGCCATTGGGGCTGCCTTGGTGG - Intronic
1037550133 8:19962712-19962734 GGTGCTTGGGGCAGCCCTGTTGG - Intronic
1037586863 8:20283000-20283022 GCACCATGGAGCATCCCTGGGGG + Intronic
1037880889 8:22572870-22572892 TGCCCTTGGGCCAGCCCTGAGGG - Intronic
1037881109 8:22573943-22573965 TGCCTCTGGAGCAGCCCTTGGGG - Intronic
1038889384 8:31701907-31701929 GTTCCTTGGAGCAGCCTTGTTGG + Intronic
1039569553 8:38576031-38576053 GGCCACTGGACCTGCCCTGGAGG + Intergenic
1040915550 8:52564322-52564344 GGCACTTGGGGCAGCGCTGGAGG - Intronic
1041030556 8:53731815-53731837 GCCCTCTGGAGCATCCCTGGGGG + Intronic
1041039504 8:53833186-53833208 GGCCCTTGCGTCAGCCCTTGTGG - Intronic
1041468655 8:58183927-58183949 GGCCCTTGAAGCAACACTGTGGG + Intronic
1043656549 8:82674509-82674531 GGCCCTAGGGGCCGCCCTGCTGG - Intergenic
1045295744 8:100870461-100870483 GTGGCTGGGAGCAGCCCTGGGGG + Intergenic
1046265408 8:111823558-111823580 CGCACTCGGAGCAGCCCTGCTGG - Intergenic
1049252606 8:141597247-141597269 GGCCCTGGGAGCAACTCTGATGG - Intergenic
1049318006 8:141979873-141979895 GGTCCTTGCCACAGCCCTGGAGG - Intergenic
1049583888 8:143424234-143424256 GGGACTTGGCTCAGCCCTGGAGG - Intronic
1049685753 8:143938720-143938742 GGGCCTGGGAGAAGCCCCGGGGG + Intronic
1049812669 8:144582448-144582470 GGCCCCAGCAGCAGCCCTGGGGG + Intronic
1049841840 8:144777994-144778016 AGCTCTGGGAACAGCCCTGGGGG - Intronic
1052851539 9:33381333-33381355 GTCCCTGGGAGGGGCCCTGGAGG - Intergenic
1056585866 9:87926720-87926742 GCCCATGGGAGCAGCCATGGGGG + Intergenic
1056611018 9:88126223-88126245 GCCCATGGGAGCAGCCATGGGGG - Intergenic
1057295041 9:93829922-93829944 GGGGCGTGGAGCAGCTCTGGGGG - Intergenic
1058447469 9:105066565-105066587 GGCCCTTAGAGCAGCCCTGCTGG - Intergenic
1060024932 9:120162839-120162861 TCTCCTTAGAGCAGCCCTGGAGG - Intergenic
1060186402 9:121566701-121566723 GGGCCTGGGAGAAGCCCTTGGGG + Intergenic
1060343924 9:122800539-122800561 GGCCATGTGCGCAGCCCTGGTGG + Exonic
1060404924 9:123368415-123368437 GGCTCTTGGAGCAGGACTTGGGG - Intronic
1061207725 9:129174330-129174352 GGCCGATGAAGCAGCCCTGGGGG + Intergenic
1061445697 9:130636005-130636027 GGCCTGAGGAGCAGCGCTGGCGG - Exonic
1061664054 9:132150009-132150031 GGCACATGGAACGGCCCTGGTGG + Intergenic
1061955843 9:133960923-133960945 CGGCCTTGGAGAAGCCCAGGAGG + Intronic
1062723070 9:138054454-138054476 GGCCCTTGGGGAAGAGCTGGGGG + Intronic
1203736798 Un_GL000216v2:144761-144783 GGCTGTGGGAGCAGCCCGGGCGG + Intergenic
1185909183 X:3966389-3966411 GCCCCGTGGAGCATCCCTGTGGG + Intergenic
1192211215 X:69129074-69129096 GGCCCCTGGAGCACAACTGGAGG - Intergenic
1195228604 X:102823426-102823448 GGCCCTTGCAGCAGCTCTCATGG + Intergenic
1198018744 X:132637404-132637426 ACCCCTTGGAGAAACCCTGGGGG + Intronic
1199878933 X:151957400-151957422 GGTCCGTGCAGCAGCTCTGGAGG - Intronic
1200207185 X:154325148-154325170 GGACCTTGGGGCTGCCCTGAAGG - Intronic
1201077532 Y:10198971-10198993 GGCCCTTGGATCGGCCCCGCCGG + Intergenic
1201904696 Y:19076920-19076942 GGGCCTTGGGTCAGGCCTGGAGG - Intergenic