ID: 1121457239

View in Genome Browser
Species Human (GRCh38)
Location 14:94046249-94046271
Sequence GAGGCCCCATTTTTCTACAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457239_1121457241 -5 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457241 14:94046267-94046289 GCCTCTGGTGTCTCTTTACCAGG 0: 1
1: 0
2: 1
3: 11
4: 163
1121457239_1121457249 16 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457249 14:94046288-94046310 GGGGCAGTGCCTCTCTGCGGGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1121457239_1121457247 14 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457247 14:94046286-94046308 CAGGGGCAGTGCCTCTCTGCGGG 0: 1
1: 0
2: 1
3: 34
4: 291
1121457239_1121457243 -4 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457243 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 1
3: 24
4: 251
1121457239_1121457244 -3 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457244 14:94046269-94046291 CTCTGGTGTCTCTTTACCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 269
1121457239_1121457250 19 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457250 14:94046291-94046313 GCAGTGCCTCTCTGCGGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 175
1121457239_1121457248 15 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457248 14:94046287-94046309 AGGGGCAGTGCCTCTCTGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 213
1121457239_1121457246 13 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457246 14:94046285-94046307 CCAGGGGCAGTGCCTCTCTGCGG 0: 1
1: 0
2: 3
3: 46
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457239 Original CRISPR GAGGCCCCATTTTTCTACAA TGG (reversed) Exonic