ID: 1121457242

View in Genome Browser
Species Human (GRCh38)
Location 14:94046268-94046290
Sequence CCCTGGTAAAGAGACACCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457242_1121457248 -4 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457248 14:94046287-94046309 AGGGGCAGTGCCTCTCTGCGGGG 0: 1
1: 0
2: 3
3: 14
4: 213
1121457242_1121457250 0 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457250 14:94046291-94046313 GCAGTGCCTCTCTGCGGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 175
1121457242_1121457246 -6 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457246 14:94046285-94046307 CCAGGGGCAGTGCCTCTCTGCGG 0: 1
1: 0
2: 3
3: 46
4: 351
1121457242_1121457252 12 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457252 14:94046303-94046325 TGCGGGGGAGGAAAAGCTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 218
1121457242_1121457247 -5 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457247 14:94046286-94046308 CAGGGGCAGTGCCTCTCTGCGGG 0: 1
1: 0
2: 1
3: 34
4: 291
1121457242_1121457249 -3 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457249 14:94046288-94046310 GGGGCAGTGCCTCTCTGCGGGGG 0: 1
1: 0
2: 0
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457242 Original CRISPR CCCTGGTAAAGAGACACCAG AGG (reversed) Exonic